Vcp a atl1 regulujú endoplazmatické retikulum a syntézu proteínov na tvorbu dendritickej chrbtice | prírodná komunikácia

Vcp a atl1 regulujú endoplazmatické retikulum a syntézu proteínov na tvorbu dendritickej chrbtice | prírodná komunikácia

Anonim

predmety

  • Bunková signalizácia
  • Vývoj nervového systému
  • Endoplazmatické retikulum

abstraktné

Nevyvážená homeostáza proteínov, ako je nadmerná syntéza proteínov a agregácia proteínov, je patogénnym puncom radu neurologických porúch. Tu pomocou expresie mutantných proteínov, knockdown prístupu a mutácie knockinovej mutácie ochorenia ukázali, že VCP (proteín obsahujúci valosín) spolu s jeho kofaktorom P47 a regulátorom morfológie endoplazmatického retikula (ER) ATL1 (Atlastin-1) reguluje. tubulárna ER tvorba a ovplyvňuje účinnosť proteínovej syntézy na kontrolu tvorby dendritickej chrbtice v neurónoch. Posilnenie významu syntézy proteínov v dendritickej spinogenéze, translačný blokátor cyklohexamid a inhibítor mTOR rapamycín znižujú hustotu dendritickej chrbtice, zatiaľ čo doplnok leucínu, ktorý zvyšuje syntézu proteínov, zlepšuje defekty dendritickej chrbtice spôsobené nedostatkami Vcp a Atl1 . Pretože VCP a ATL1 sú príčinnými génmi niekoľkých neurodegeneratívnych a neurodevelopmentálnych porúch, navrhujeme, aby narušená tvorba ER a neúčinná syntéza proteínov boli významné v patogenéze viacerých neurologických porúch.

úvod

Proteínová homeostáza, integrovaný výsledok syntézy a degradácie proteínov, je rozhodujúca pre zachovanie rôznych bunkových funkcií. Je známe, že nevyvážená homeostáza bielkovín spôsobená nadmernou syntézou bielkovín, defektnou degradáciou bielkovín a agregáciou bielkovín je spojená s mnohými neurologickými poruchami 1, 2, 3, 4, 5 . VCP , tiež známy ako P97 , je jedným z génov kontrolujúcich proteínovú homeostázu a je tiež asociovaný s neurologickými poruchami.

Vcp kóduje hexamérnu AAA + ATPázu, ktorá funguje ako chaperón na kontrolu rôznych bunkových procesov, vrátane degradácie proteínov asociovaných s endoplazmatickým retikulám (ERAD) 6, 7, systému proteazómu ubikvitínu (UPS) 8, 9, ER a Golgiho morfogenézy. 10, 11, 12, 13, 14, 15, 16, 17 a ďalšie 9, 18, 19 . Záväzní partneri VCP určujú svoje rozmanité aktivity 9, 20, 21 . Napríklad, keď ubikvitínový fúzny degradačný 1-like (UFD1L) -jadrový proteín na lokalizáciu nukleových proteínov 4 (NPL4) viaže VCP, komplex VCP je zapojený do ERAD a UPS 6, 7, 9 (obrázok la, spodná časť). Zatiaľ čo VCP interaguje s iným kofaktorom s názvom P47, známym tiež ako kofaktor NSFL1 (P97), reguluje fúziu membrán v ER a Golgiho morfogenéze 10, 11, 12, 13, 14, 22 (obr. La, hore). P47 súťaží s UFD1L – NPL4 heterodimérom o interakciu s N-terminálnou oblasťou VCP 23 . Očakáva sa teda, že úrovne expresie kofaktorov ovplyvňujú funkciu VCP v bunkách súťažením o interakcie a zameraním VCP na rôzne proteínové mašinérie.

Image

a ) Schéma VCP hexamérov a ich kofaktorov P47 a diméru UFDL1-NPL4 v dvoch rôznych funkciách. Heterohexaméry, ktoré obsahujú VT (otvorený kruh) a mutantný (uzavretý kruh) VCP, sú neaktívne. ( b, d, f, h ) Kultivované neuróny boli kotransfekované GFP-aktínom a uvedenými plazmidmi po 12 dňoch in vitro (DIV) a fixované pre analýzu dendritickej chrbtice pri 18 DIV. Expresia rôznych konštruktov bola monitorovaná imunofluorescenčným farbením, aj keď iba signály GFP ukazujú neuronálnu morfológiu. Ľavé panely ilustrujú experimentálny návrh a predpokladanú aktivitu komplexov VCP. Šípky smerujúce nahor alebo nadol naznačujú buď zmeny v hladinách proteínov alebo aktivity komplexov. Na obrázkoch sú zväčšené spodné panely kvantifikovanými segmentmi z horných panelov. ( c, e, g, i ) Kvantifikácia výčnelkových hustôt získaných z troch nezávislých experimentov. Sú uvedené priemery plus sem a kumulatívna pravdepodobnosť. Uvádzajú sa veľkosti vzoriek ( n ) analyzovaných dendritov. Ctrl, kontrola bez stlmenia. Mierka: pôvodná, 20 μm; zväčšené, 2 μm. ** P <0, 01; *** P <0, 001. Nepárový t- test ( c ); jednosmerná ANOVA ( e, g, h ); Kolmogorov – Smirnovov test na kumulatívnu pravdepodobnosť ( c, e, g, i ).

Obrázok v plnej veľkosti

Proteíny VCP sú všadeprítomne exprimované v rôznych tkanivách. Mutácie v géne VCP vedú k multisystémovým poruchám, ako je napríklad myopatia inklúzneho tela spojená s Pagetovou chorobou kostí a frontotemporálnou demenciou (IBMPFD) 24, amyotropná laterálna skleróza 25, 26 a poruchy spektra autizmu 27 . Medzi týmito chorobami sa delí neurologická dysfunkcia. Naša predchádzajúca štúdia ukázala, že VCP interaguje s inou molekulou choroby, neurofibromínom, ktorá je kódovaná génom typu I neurofibromatózy, a pôsobí downstream od neurofibromínu na reguláciu tvorby dendritickej chrbtice - subcelulárnej lokalizácie excitačných synapsií 28 . Zapojenie VCP do tvorby dendritickej chrbtice poskytuje potenciálne vysvetlenie pre dysreguláciu neurónovej funkcie u pacientov s mutáciami VCP , hoci nie je jasné, ako VCP riadi tvorbu dendritickej chrbtice.

Pretože funkciu VCP určuje jej kofaktor, v tejto správe skúmame funkcie dvoch hlavných kofaktorov VCP - P47 a diméru UFD1L-NPL4 - aby sme preskúmali, ako VCP riadi dendritickú spinogenézu. Naše výsledky ukazujú, že P47, ale nie dimér UFD1L-NPL4, sa podieľa na tvorbe dendritickej chrbtice sprostredkovanej VCP. Naša štúdia naznačuje, že komplex VCP-P47 pôsobí s regulátorom ER, ATL1, na reguláciu morfológie a syntézy proteínov ER, ktoré sú rozhodujúce pre dendritickú spinogenézu.

výsledok

P47 pôsobí s VCP na reguláciu dendritickej hustoty chrbtice

V našej predchádzajúcej proteomickej štúdii P47 - kofaktorom riadená VCP-sprostredkovaná regulácia fúzie ER membrán - vytvoril komplex s VCP a neurofibromínom v extraktoch mozgu potkana 28 . Skúmali sme teda, či sa P47 podieľa aj na dendritickej spinogenéze. Kultivované hipokampálne neuróny boli transfekované P47 po 12 dňoch in vitro (DIV) a potom sme analyzovali dendritickú hustotu chrbtice pri 18 DIV. Zistili sme, že v porovnaní s kontrolou vektorov mali neuróny transfekované P47 vyššiu hustotu dendritických chrbtíc (obr. 1b, c). Na ďalšie potvrdenie funkcie P47 sme použili prístup RNA interferencie na zníženie expresie P47. P47 RNAi knockdown konštrukt (P47i), ktorý znížil expresiu P47 v transfektovaných bunkách COS-1 aj v kultivovaných hipokampálnych neurónoch (doplnkový obrázok la, b), sa transfekoval do kultivovaných neurónov. Signály GFP z knockdown vektora a koexprimovaného GFP-aktínu sa použili na označenie transfekovaných buniek a tiež na načrtnutie neuronálnej morfológie a dendritických chrbtíc. Podobne ako v predchádzajúcich výsledkoch pre deficity Vcp a Nf1 28, 29, zníženie expresie P47 znížilo hustotu dendritických ostní (obr. 1d, e). Koexpresia tichého mutanta P47, ktorý je rezistentný na P47i (doplnkový obrázok la), zachránil defekty dendritickej chrbtice spôsobené knockdownom P47 (obrázok 1d, e), čo naznačuje špecificitu P47i. Aby sme minimalizovali osobné zaujatosť, uskutočnili sme pre túto správu experimenty so slepou morfometriou.

Potom sme skúmali zapojenie P47 do dendritickej spinogenézy sprostredkovanej VCP. Ukázalo sa, že knockdown endogénneho VCP aj nadmerná expresia VCP R95G mutantu - IBMPFD mutanta - znižujú počet dendritických chrbtíc 28 . V prípade VCp knockdown neurónov (∼ 60% zníženie 28 ) nadmerná expresia P47 pravdepodobne verbuje zvyškový VCP na vykonávanie aktivít závislých od P47 a môže zmierniť defekty chrbtice. Naopak, expresia VCP R95G mutantu zhoršuje aktivity všetkých hexamérnych VCP v neurónoch (obr. La, vpravo). Preto sa neočakávalo, že nadmerná expresia P47 zachráni defekt spôsobený mutantom VCP R95G (Obr. 1f, h, ľavé panely). Nadmerná expresia P47 skutočne zvýšila dendritickú hustotu chrbtice v knockdown neurónoch Vcp (obr. 1f, g), ale nie v neurónoch exprimujúcich mutant VCP R95G (obr. 1h, i). Výsledky naznačujú, že VCP používa P47-závislú cestu na reguláciu dendritickej hustoty chrbtice.

Degradácia proteínu závislá od UFD1L nie je kritická

Okrem cesty závislej na P47 sme tiež skúmali, či sa pri tvorbe dendritickej chrbtice podieľa degradácia proteínu riadená komplexom VCP – UFD1L – NPL4 (doplnkový obrázok 2a). Pretože UFD1L a NPL4 fungujú ako dimér, na zníženie ich funkcie postačuje redukcia jedného z nich. Zrútili sme expresiu Ufdl v bunkách COS-1 a kultivovali sme hipokampálne neuróny (doplnkový obrázok 2b, c) a zistili sme, že dendritická hustota chrbtice sa nezmenila (doplnkový obrázok 2d, e). Aby sa zaistilo, že knockdown Ufd1l pomocou Ufd1i zhoršuje degradáciu proteínov, použili sme ERAD reportér (CD3δ-GFP) a nestabilný fluorescenčný proteín (Ub G76V -GFP) na monitorovanie degradácie proteínu. Tieto GFP fúzne proteíny sú nestabilné a rýchlo degradované. Hromadenie signálu GFP preto indikuje zhoršenú degradáciu proteínov. V porovnaní s kontrolou bez tlmenia expresia Ufd1i indukovala jasné punkčné signály pre CD3δ-GFP a Ub G76V -GFP (doplnkový obrázok 2f, g), čo naznačuje, že knockdown Ufd1l podporoval akumuláciu rozloženého proteínu. Aby sa ďalej potvrdilo, že rozložená proteínová akumulácia nepoškodzuje dendritickú spinogenézu, ošetrili sme kultivované neuróny tunicamycínom, ktorý blokuje syntézu N-naviazaných glykoproteínov, aby sa vyvolala rozložená proteínová akumulácia a stres ER. Ošetrenie tunicamycínom vyvolalo eIF2 fosforyláciu a akumuláciu CD3δ-GFP (doplnkový obrázok 3a, b). Novo syntetizované proteíny sme tiež označili 1 h metionínovým analógom L-azidohomoalanínom (AHA) pri 18 DIV použitím dobre zavedeného spôsobu bioorthogonálneho nekanonického značenia aminokyselín (BONCAT) 30 . Po premytí boli AHA-značené proteíny detegované s použitím tetrametylrhodamínového (TAMRA) -konjugovaného alkínu kombinovaného s TAMRA protilátkou. Syntéza proteínov bola prechodne inhibovaná 2 a 6 hodín po ošetrení tunicamycínom, ale postupne sa izolovala (doplnkový obrázok 3c). Tieto analýzy ukázali, že tunicamycín indukoval rozvinutú proteínovú reakciu a viedol k akumulácii proteínu v neurónoch. Liečba tunicamycínom však nezmenila dendritickú hustotu chrbtice a morfológiu buniek neurónov (doplnkový obrázok 3d). Vyjadrujúc nedostatok účinku tunicamycínu na tvorbu dendritickej chrbtice, úrovne expresie synaptických proteínov - ako sú podjednotky receptorov N-metyl-D-subpartátu GRIN2A a GRIN2B (tiež známe ako NMDAR2A a NMDAR2B), a -amino-3-hydroxy- Podjednotka receptora kyseliny 5-metyl-4-izoxazolepropiónovej GRIA2 / 3 (tiež známa ako GluR2 / 3), metabotrofický glutamátový receptor GRM5 (tiež známa ako mGluR5) a proteíny synaptických skafoldov PSD-95 a CASK - nevykazovali výrazný redukčný vzorec po Liečba tunicamycínom (doplnkový obrázok 3e). Možno sú tieto synaptické proteíny relatívne stabilné 31 a nemôžu byť ovplyvnené prechodným potlačením translácie proteínov. Aj keď liečba tunicamycínom vyvolala rozvinutú proteínovú reakciu, mala veľmi obmedzený účinok na dendritické chrbtice.

Tieto výsledky spolu naznačujú, že je nepravdepodobné, že by sa rozvinutá proteínová reakcia zúčastňovala na dendritickej spinogenéze závislej od VCP.

VCP a P47 regulujú distribúciu dendritickej ER v neurónoch

V deliacich sa bunkách je komplex VCP-P47 známy tým, že riadi homotypickú membránovú fúziu intracelulárnych organel vrátane ER 12, 13, 15, 16, 17 . Úloha komplexu VCP-P47 v morfogenéze ER a jeho následná fyziologická funkcia je však v neurónoch úplne neznáma. Pretože lokálna tubulárna ER komplexita v dendritoch koreluje s hustotou lokálnych dendritických chrbtíc 32, skúmali sme, či proteínový komplex VCP-P47 reguluje tvorbu tubulárnej ER a rozširovanie ER do dendritov. Na označenie ER v kultivovaných neurónoch sa použil DsRed-ER - červený fluorescenčný proteín (DsRed) fúzovaný so zameriavacou sekvenciou ER calreticulínu na svojom N-terminálnom konci a s ER retenčnou sekvenciou KDEL na svojom C-terminálnom konci. Profil DsRed-ER v neurónoch sa dobre prekrýval so vzorcom endogénneho kalreticulínu, ako bolo analyzované pomocou 3D-SIM (obr. 2a), čo podporuje to, že signály DsRed-ER odrážajú endogénnu distribúciu ER. Podobne ako v predchádzajúcom zistení 32, DsRed-ER bol obohatený v dendritických vetviach a bázach dendritických ostní (obr. 2a, b, e, h).

Image

a ) 3D SIM obrázky kultivovaných hipokampálnych neurónov. DsRed-ER a Myc-značený WT Vcp alebo R95G mutant sa kotransfekovali do neurónov pri 12 DIV a analyzovali sa imunofarbením s použitím Myc, DsRed a endogénnych protilátok proti markeru kalreticulínu (CRT) pri 18 DIV. ( b - i ) DsRed-ER sa kotransfekoval s uvedenými plazmidmi do kultivovaných neurónov. Série Z konfokálnych obrazov boli spracované pomocou softvéru Surpass Mode (Impass) v softvéri Imaris (Bitplane), ako je znázornené na obrázkoch ( b, e, h ). Šípky označujú príklady dendritických vetiev s obohatenou ER. ( c, f, i ) Pomer dendritických DsRed k somatickým DsRed (D / S) a celkový počet dendritov. ( d, g ) Kumulatívna pravdepodobnosť dendritických DsRed-ER ukazuje akumuláciu DsRed-ER v proximálnej oblasti dendritov v bunkách exprimujúcich P47i- a R95G. Ctrl, kontrola bez stlmenia. Mierka: a ) pôvodná, 10 μm; zväčšené, 2 μm; ( b, e, h ) originál, 20 μm; zväčšené, 2 μm. Údaje pochádzajú z troch nezávislých experimentov a sú uvedené ako priemer plus sem (chybové stĺpce). Uvádzajú sa veľkosti vzoriek ( n ) skúmaných neurónov. * P <0, 05; ** P <0, 01; *** P <0, 001. Nepárový t- test ( c, f ); obojsmerná ANOVA ( d, g, i ).

Obrázok v plnej veľkosti

Potom sa určil pomer dendritického DsRed-ER k somatickému DsRed-ER (pomer D / S), aby sa zistilo, či nedostatky Vcp a P47 regulujú tubulárne predĺženie ER v neurónoch. Pomer D / S knockdown neurónov P47 bol podstatne nižší ako pomer kontrolných neurónov (obr. 2b, c). Pretože knockdown P47 zreteľne nezmenil počet dendritov (obr. 2c, spodný panel), nižší pomer D / S naznačil, že do jednotlivých dendritov v P47 neurónoch P47 bolo distribuovaných menej ER. Keď sme zmerali kumulatívnu pravdepodobnosť DsRed-ER pozdĺž dendritov, v proximálnych dendritoch P47 knockdown neurónov bolo prítomné relatívne vyššie percento ER (obr. 2d), čo naznačuje deficit v predĺžení ER pozdĺž dendritov. Podobné defekty ER sa našli aj v neurónoch exprimujúcich VCP R95G a knockdown Vcp (obr. 2e – i). Tieto výsledky naznačujú, že nedostatky Vcp a P47 znižujú predĺženie ER zo somaty do dendritov.

Pre dendritickú spinogenézu nadmerná expresia P47 účinne zmiernila defekt dendritickej chrbtice spôsobený knockdownovaním Vcp (obr. 1f, g). Ak sú defekty ER relevantné pre defekty dendritickej chrbtice, očakávali sme, že nadmerná expresia P47 by zachránila defekty ER spôsobené knockdownom Vcp . Nadmerná expresia P47 v knockdown neurónoch Vcp skutočne zvýšila pomer D / S DsRed-ER k hladine kontrolných neurónov (obr. 2h – i). VCP a P47 teda spoločne riadia distribúciu ER a tvorbu dendritickej chrbtice.

VCP a P47 regulujú distribúciu ER in vivo

Okrem kultivovaných neurónov sme ďalej hodnotili úlohu VCP a P47 v distribúcii ER in vivo s použitím u elektroporovaných myší utero. VCPi a DsRed-ER boli dodané do mozgovej kôry v embryonálnom dni 15.5. Kortikálne neuróny vrstvy 2/3 sa potom analyzovali v postnatálny deň 3. V súlade s výsledkami kultivovaných neurónov sa pomer D / S DsRed-ER zreteľne znížil vo Vcp knockdown neurónoch (obr. 3a, b). To naznačuje, že extenzia ER do dendritov bola tiež narušená vo vrstvách 2/3 kortikálnych neurónov, keď boli úrovne expresie Vcp in vivo znížené. Okrem toho nadmerná expresia P47 zlepšila defekty extenzie ER spôsobené knockdownom Vcp (obr. 3a, b). Celkovo teda štúdie in vivo aj in vitro naznačujú, že komplex VCP-P47 reguluje tvorbu a rozšírenie tubulárnej ER v neurónoch.

Image

( a ) Elektroporácia in vitro s uvedenými plazmidmi sa uskutočnila pri E15, 5 myší CD1. Kortikálne neuróny vrstvy 2/3 sa potom imunofarbili protilátkami GFP, DsRed a Myc v P3, aby sa načrtla morfológia buniek a stanovila sa distribúcia ER v neurónoch. Série Z konfokálnych obrazov boli spracované pomocou softvéru Surpass Mode (Impass) v softvéri Imaris (Bitplane). b ) pomer dendritického DsRed k somatickému DsRed (D / S). Mierka: 10 μm. Ctrl, kontrola bez stlmenia. Analyzovali sa štyri až päť mláďat pre každú skupinu. Sú uvedené počty skúmaných neurónov ( n ). Údaje sú uvedené ako priemer + sem (chybové stĺpce). NS, nevýznamné; *** P <0, 001; obojsmerná ANOVA.

Obrázok v plnej veľkosti

Somatická hrubá ER je tiež narušená mutáciou VCP R95G

Pretože ER je súvislá membránová štruktúra siahajúca od jadrového obalu k celej bunke, dendritická ER chyba spôsobená nedostatkami Vcp a P47 (obrázky 2 a 3) naznačuje, že je pravdepodobne tiež ovplyvnená ER v soma. Na skúmanie tejto možnosti sme generovali mutantné myši exprimujúce mutantné proteíny VCP R95G pomocou prístupu zameraného na gén (obr. 4a – d) a kultivovali sme hipokampálne neuróny z mutantných embryí a vrhu divokého typu. Pretože IBMPFD je dominantne dedičná, myši Vcp WT / R95G (ďalej označované ako VCP R95G knockinové myši) sa použili na preskúmanie účinku mutácie Vcp . Pri 18 DIV sa kultivované neuróny analyzovali pomocou transmisnej elektrónovej mikroskopie (TEM) (obr. 4e). Bola stanovená dĺžka jednotlivých hrubých ER (rER) a hustota pripojených ribozómov na ER. Zistili sme, že dĺžka rER sa značne skrátila vo VCP R95G knockinových neurónoch (obr. 4e, f). Všimnite si, že sme naslepo nasnímali podobný počet obrázkov z VCP R95G knockinových neurónov a neurónov divokého typu a zistili sme, že fragmenty rER v neurónoch knockínových neurónov VCP R95G boli oveľa menšie. To viedlo k menšej veľkosti vzorky rER vo VCP R95G knockinových neurónoch (obr. 4f, g, divoký typ, n = 722; R95G, n = 497). Tieto údaje naznačujú, že mutácia VCP R95G redukovala rozšírenie a hojenie rER. Okrem toho sme zistili, že hustota ribozómov pripojených k ER bola tiež oveľa nižšia v neurónoch knockínových neurónov VCP R95G (obr. 4e, g), čo by malo ovplyvniť aktivitu syntézy proteínov v knockínových neurónoch VCP R95G. Výsledky z TEM spoločne naznačujú, že mutácia VCP R95G zhoršuje morfológiu a fungovanie ER v soma.

Image

( a ) Schéma organizácie genómu myší Vcp a návrh konštruktu zameraného na knockin R95G. Tmavé pole a otvorené pole označuje mutované exóny WT a Vcp R95G (R95G). ( b ) Genomická analýza Southern blotting s 5 'sondou: 7, 1 kb pre WT a ďalších 2, 7 kb pre Vcp wt / R95G (R95G) myši; 3 'sonda: 7, 1 kb pre WT a ďalších 6, 2 kb pre R95G myši. ( c ) Genotypizácia pomocou PCR so sadou primérov 1: produkty 475 bp pre WT a ďalších 711 bp pre R95G myši; sada primérov 2: produkty 497 bp pre WT a 500 bp pre R95G alelu. Produkt R95G PCR bol štiepený EcoRV za vzniku fragmentov 236 a 264 bp. V písmenách b), c ) sa obrázky orezali na prezentáciu. Obrázky v plnej veľkosti sú uvedené na doplnkovom obrázku 9. d ) Výsledky sekvenovania produktu PCR amplifikovaného sadou primérov 2 na odhalenie mutácií R95G a EcoRV. ( e ) TEM analýza kultivovaných hipokampálnych neurónov z myší WT a R95G pri 18 DIV. Neuróny sa odobrali od deviatich myší pre každú skupinu z troch nezávislých experimentov. Počet analyzovaných neurónov: WT, 120; R95G, 132. Chybové stĺpce predstavujú priemer + sem. N, jadro. ( f, g ) Kvantifikovala sa dĺžka a ribozomálna hustota rER. Mierka: 500 nm. *** P <0, 001; nepárový t- test.

Obrázok v plnej veľkosti

Syntéza proteínov je narušená deficitom Vcp a P47

Pretože abundancia a ribozomálna väzba na rER bola výrazne ovplyvnená deficitom Vcp a pretože hlavnou funkciou rER je syntetizácia proteínov vrátane membránových / sekretovaných proteínov a cytosolických proteínov 33, 34, 35, skúmali sme účinky VCP a P47 na Syntézy bielkovín. Novo syntetizované proteíny boli označené metódou BONCAT 30 . Po intenzívnom premytí na odstránenie voľného AHA sa proteíny začlenené do AHA detegovali pomocou alkínu konjugovaného s Alexa Fluor-488. Zistili sme, že expresia VCP R95G mutantu inhibovala syntézu proteínu v dendritoch (obr. 5a, b). Okrem toho sa tiež výrazne znížila syntéza proteínov v somate (Obr. 5a, c), čo naznačuje globálny defekt v syntéze proteínov v VCP R95G mutantných neurónoch. Táto globálna redukcia proteínovej syntézy sa ukázala aj v kultivovaných hipokampálnych neurónoch pri 18 DIV pripravených z myší VCP R95G knockin (doplnkový obrázok 4a, b). Expresia VCP R95G mutantu v kultivovaných neurónoch vykazovala časovo závislé účinky. Expresia počas 6 dní (DIV 12 + 6) redukovala novo syntetizovaný proteín v priemere o 70% (obr. 5a, c), zatiaľ čo neuróny exprimujúce mutantu R95G 2 (DIV 12 + 2) alebo 4 dni (DIV 12+ 4) inhibovala syntézu proteínov asi 40% (obr. 5a, c). Okrem toho, keď sa značenie AHA predĺžilo na 4 alebo 6 hodín, nebol zrejmý rozdiel medzi signálmi AHA v neurónoch exprimujúcich mutanty WT- a R95G (obr. 5d, e). Nedostatok rozdielu po dlhšej inkubačnej dobe pravdepodobne nebude spôsobený saturáciou značenia AHA, pretože signály AHA sú silnejšie s dlhším časom značenia (obr. 5d, e). Tieto údaje naznačujú, že nedostatok Vcp zhoršuje účinnosť proteínovej syntézy v neurónoch.

Image

Kultivované neuróny boli transfekované s WT VCP alebo R95G mutantom pri ( a - e ) 12 DIV a ( f, g ) 2 DIV a syntéza proteínov bola analyzovaná pomocou značenia AHA o 2, 4 alebo 6 dní neskôr, ako je uvedené. Značenie AHA sa detegovalo pomocou alkínom modifikovaného Alexa Fluor-488. a, d, f ) Reprezentatívne obrázky označenia AHA. Vložky označujú transfekované bunky, ktoré sú na pôvodných obrázkoch vyznačené šípkami alebo šípkami. b ) Relatívne intenzity AHA v dendritoch. ( c, e, g ) Relatívne signály AHA v somate. V ( a - c, f, g ) bola AHA označená 1 h; v ( d, e ) sa AHA pridala do kultúry na 4 alebo 6 hodín, ako je uvedené. V bode f ) sa na potvrdenie špecifickosti označenia AHA použila vynechanie AHA alebo pridanie cykloheximidu (Chx; 10 μM). Mierka: 25 μm. Uvádzajú sa veľkosti vzoriek ( n ) analyzovaných neurónov. Dáta z troch nezávislých experimentov sú uvedené ako priemer + sem (chybové stĺpce). NS, nevýznamné; ** P <0, 01; *** P <0, 001. Nepárový t- test ( b, c, e ); jednosmerná ANOVA ( g ).

Obrázok v plnej veľkosti

Okrem zrelých neurónov sme skúmali aj účinok mutácie VCP R95G na nezrelé neuróny. Kultivované hipokampálne neuróny boli transfekované s WT VCP alebo R95G mutantom pri 2 DIV a analyzované pri 8 DIV. Podobne ako pri použití zrelých neurónov pri 18 DIV, expresia mutantu VCP R95G tiež znížila syntézu proteínov v nezrelých neurónoch pri 8 DIV (obr. 5f, g). Kontroly vynechania AHA a pridania cykloheximidu nevykazovali žiadny zrejmý signál podporujúci špecificitu AHA (obr. 5f, g). V súlade s poruchami syntézy proteínov bola distribúcia ER v dendritoch tiež znížená v neurónoch exprimujúcich mutanty VCP R95G pri 8 DIV (doplnkový obrázok 5a, b). Spoločne tieto výsledky naznačujú, že nedostatok Vcp zhoršuje distribúciu ER a syntézu proteínov v nezrelých, ako aj v zrelých neurónoch.

Knockdown Vcp a P47 mal tiež negatívny vplyv na syntézu proteínov (obr. 6a – d). Negatívne účinky boli špecificky spôsobené znížením expresie Vcp a P47, pretože expresia tichých mutantov Vcp a P47, ktoré sú rezistentné voči Vcp a P47 knockdown konštruktom, zachránila syntézu proteínov v neurónoch exprimujúcich príslušné knockdown konštrukty (Obr. 6a – d)., Okrem toho, podobne ako distribúcia ER a tvorba dendritickej chrbtice, nadmerná expresia P47 účinne zvýšila syntézu proteínov vo Vcp knockdown neurónoch (obr. 6e, f). VCP a P47 teda spoločne regulujú distribúciu ER, syntézu proteínov a tvorbu dendritickej chrbtice v neurónoch.

Image

Kultivované neuróny boli kotransfektované uvedenými knockdown a expresnými konštruktmi pri 12 DIV a podrobené značeniu AHA po dobu 1 hodiny pri 18 DIV. a, c, e ) Reprezentatívne obrázky označenia AHA. Vložky označujú transfekované bunky, ktoré sú na pôvodných obrázkoch vyznačené šípkami alebo šípkami. ( b, d, f ) Relatívna intenzita AHA v somate. V e ) sa na potvrdenie špecifickosti označenia AHA použila vynechanie AHA alebo pridanie cykloheximidu (Chx; 10 μM). Na označenie prítomnosti neurónov sú v týchto dvoch skupinách uvedené signály DAPI. Ctrl, kontrola bez stlmenia. Mierka: 25 μm. Uvádzajú sa veľkosti vzoriek ( n ) skúmaných neurónov. Dáta z troch nezávislých experimentov sú uvedené ako priemer + sem (chybové stĺpce). * P <0, 05; ** P <0, 01; *** P <0, 001. Jednosmerná ANOVA ( b, d ), dvojcestná ANOVA ( f ).

Obrázok v plnej veľkosti

Okrem BONCAT sme použili ďalšiu metódu - povrchové snímanie translácie (SUnSET) 36 - na sledovanie syntézy proteínov prostredníctvom inkorporácie puromycínu do neurónov. Puromycín pripomína 3 'koniec transferovej RNA a inkorporuje sa do syntetizujúcich polypeptidových reťazcov 37 . Proteíny značené puromycínom sa potom môžu detegovať pomocou puromycínovej protilátky. Podobne ako výsledky pri použití značenia AHA, znižovanie Vcp znížilo značenie puromycínu a nadmerná expresia P47 zachránila začlenenie puromycínu do VCp knockdown neurónov (doplnkový obrázok 6). Záverom možno povedať, že BONCAT aj SUnSET odhaľujú defekty syntézy proteínov spôsobené nedostatkami Vcp a P47 .

Niektoré synaptické iónové kanály sú menej exprimované vo mutantoch Vcp

Aby sme podrobnejšie preskúmali jeho kontrolu hustoty dendritickej chrbtice, popri jej účinku na syntézu proteínov odhalenú značením AHA a puromycínom sme sa tiež pýtali, či nedostatok Vcp ovplyvňuje expresiu synaptických membránových proteínov. Testovali sme niekoľko glutamátových receptorov, ktoré sú obohatené o dendritické chrbtice a sú kritické pre ich fungovanie, a zistili sme, že úrovne expresie GRIN2B a GRIA2 / 3 boli zreteľne nižšie v neurónoch knockínových neurónov VCP R95G (obr. 7a, b). Hladiny GRIN2A mali tiež tendenciu byť nižšie vo VCP R95G knockinových neurónoch, ale rozdiel nedosiahol štatistickú významnosť. U GRIA1 a GRM5 boli ich proteínové hladiny porovnateľné medzi WT a VCP R95G knockínovými neurónmi (obr. 7a, b). Hladiny proteínu PSD-95 neboli ovplyvnené mutáciou VCP R95G (obr. 7a, b). Tieto výsledky naznačujú, že niektoré synaptické iónové kanály sú zvlášť citlivé na VCP R95G mutáciu.

Image

( a ) Synaptické proteínové expresie hipokampálnych neurónov z myší WT a VCP R95G pri 18 DIV. b ) Kvantifikácia podľa písmena a ), normalizovaná podľa CASK. Extrakty získané z celkom šiestich rôznych myší pre každý genotyp sa porovnajú. Údaje sú uvedené ako priemer + sem (chybové stĺpce). * P <0, 05; ** P <0, 01; nepárový t- test. Obrázky boli orezané na prezentáciu. Obrázky v plnej veľkosti sú uvedené na doplnkovom obrázku 9.

Obrázok v plnej veľkosti

Inhibícia syntézy proteínov znižuje hustotu synapsií

Vyššie uvedené výsledky naznačujú, že defektná syntéza proteínov pravdepodobne znižuje dendritickú hustotu chrbtice vo Vcp - a P47- deficitných neurónoch. V tomto scenári sme očakávali, že inhibícia syntézy proteínov pri iných ošetreniach by tiež mala znížiť dendritickú hustotu chrbtice. Na skúmanie tejto možnosti sa použili cykloheximid a rapamycín - inhibítor cicavčieho cieľa rapamycínu (mTOR) 38, 39 . Ako sa očakávalo, predinkubácia s cykloheximidom a rapamycínom znížila inkorporáciu AHA v neurónoch (obrázok 8a). Čo je dôležitejšie, ošetrenie cykloheximidom a rapamycínom tiež znížilo dendritickú hustotu chrbtice (obrázok 8b). Inhibičné účinky cykloheximidu a rapamycínu na dendritickú hustotu chrbtice sú v súlade s našou hypotézou, že syntéza proteínov je rozhodujúca pre reguláciu hustoty dendritickej chrbtice.

Image

( a ) Ošetrenie cykloheximidom (Chx, 10 μM) a rapamycínom (Rapa, 10 nM) počas 6 hodín inhibovalo proteínovú syntézu kultivovaných neurónov, ako bolo odhalené signálmi AHA s protilátkou TAMRA. Obrázky boli orezané na prezentáciu. Obrázky v plnej veľkosti sú uvedené na doplnkovom obrázku 9. b ) Kultivované neuróny transfekované GFP-aktínom na obrys dendritických chrbtíc boli ošetrené Chx a Rapa počas 6 alebo 24 hodín pred imunofarbením GFP protilátkou. Vozidlo, vozidlo. Mierka: pôvodná, 20 μm; zväčšené, 2 μm. Uvádzajú sa veľkosti vzoriek ( n ) skúmaných dendritov. Dáta z troch nezávislých experimentov sú uvedené ako priemer + sem (chybové stĺpce). * P <0, 05; ** P <0, 01; *** P <0, 001; jednosmerná ANOVA.

Obrázok v plnej veľkosti

Obnovenie syntézy proteínov zlepšuje defekty synapsie

Ak je syntéza proteínov skutočne kľúčovou downstream cestou VCP a P47, ktorá riadi tvorbu dendritickej chrbtice, očakáva sa, že zvýšená regulácia syntézy proteínov v neurónoch s deficitom Vcp a P47 zlepší dendritické defekty chrbtice. Je známe, že leucín, aminokyselina s rozvetveným reťazcom, zvyšuje syntézu proteínov aktiváciou mTOR dráhy 40, 41, 42 . Do kultivačného média sa pridal ďalší leucín, aby sa zvýšili koncentrácie zo základnej hladiny (0, 8 mM) na 2, 2, 5 alebo 5 mM. Zistili sme, že ďalší leucín účinne indukoval fosforyláciu ribozomálneho proteínu S6 v neurónoch spôsobom závislým od dávky (obr. 9a). Pridanie leucínu do 2, 5 mM v kultivovaných neurónoch bolo dostatočné na zmiernenie defektov syntézy proteínov spôsobených mutantom VCP R95G (obr. 9b, c). Dodatočný leucín však nezlepšil distribúciu ER v mutantných neurónoch VCP R95G (obr. 9d, e). Čo je dôležitejšie, zistili sme, že ďalší leucín zvýšil dendritickú hustotu chrbtice neurónov exprimujúcich mutant VCP R95G na úroveň neurónov exprimujúcich WT VCP (obr. 9f). Aby sa ďalej potvrdila úloha proteínovej syntézy pri účinku leucínu na dendritickú hustotu chrbtice, rapamycín a CGP57380 - inhibítor serín / treonín-proteínkinázy 1 interagujúcej s MAP kinázou (MNK1) 43 - sa aplikovali na neuróny ošetrené ďalším leucínom., Zistili sme, že obidva inhibítory účinne potlačili účinok ďalšieho leucínu na tvorbu dendritickej chrbtice (obr. 9g a doplnkový obr. 7a, b).

Image

( a ) Zvýšené koncentrácie leucínu v médiu indukujú fosforyláciu ribozomálnych proteínov S6 v kultivovaných neurónoch. Bazálna koncentrácia leucínu v neurobazálnom médiu je 0, 8 mM. Bloky plnej veľkosti sú uvedené na doplnkovom obrázku 9. ( b - g ) Kultivované neuróny boli transfekované uvedenými plazmidmi pri 12 DIV, ošetrené rôznymi koncentráciami leucínu pri 15 DIV a analyzované na začlenenie ( b, c ) AHA, ( d, e ) distribúcia ER a ( f, g ) dendritická hustota chrbtice pri 18 DIV. Obrázky buniek v plnej veľkosti podľa bodu ( f ) sú znázornené na doplnkovom obrázku 7a. V ( b ) sú transfekované neuróny na obrázkoch buď naznačené alebo označené šípkami. g ) Rapamycín (Rapa; 10 nM) a inhibítor MNK1 CGP57380 (CGP; 10 uM) sa pridali 6 hodín pred zberom, aby sa znížil priaznivý účinok leucínu na dendritickú hustotu chrbtice. Obrázky buniek ( g ) v plnej veľkosti sú znázornené na doplnkovom obrázku 7b. Mierka ( b, d ) 20 μm; d ), zväčšené af ) 2 μm. Dáta z troch nezávislých experimentov sú uvedené ako priemer + sem (chybové stĺpce). Uvádzajú sa veľkosti vzoriek ( n ) skúmaných neurónov ( c, e ) a dendritov ( f, g ). * P <0, 05; ** P <0, 01; *** P <0, 001; NS, nevýznamné. One-way ANOVA ( a ); two-way ANOVA ( c, e, f, g ).

Obrázok v plnej veľkosti

Taken together, these results suggest that leucine is able to ameliorate the defects in dendritic spines caused by a Vcp deficiency by inducing protein synthesis. These results strengthen our hypothesis that inefficient protein synthesis is the critical impairment downstream of Vcp deficiency in controlling dendritic spine formation.

ATL1 and RAB10 control protein synthesis and synapse density

To further investigate the involvement of ER malformation and dysfunction in dendritic spinogenesis, we examined the function of ATL1 and RAB10 in cultured hippocampal neurons. ATL1 is a causative gene of hereditary spastic paraplegia 3A (SPG3A) and encodes a dynamin-like GTPase to control homotypic membrane fusion of tubular ER 44, 45, 46 . The R217Q mutation of ATL1 with defective GTPase activity has been identified in patients with SPG3A 47 . Cultured hippocampal neurons were cotransfected with DsRed-ER and the WT or R217Q mutant of ATL1. As expected, ATL1 R217Q mutant-expressing cells had a lower D/S ratio of DsRed-ER compared with neurons transfected with WT Atl1 or control vector (Fig. 10a, d). Consistent with our hypothesis, expression of the ATL1 R217Q mutant noticeably impaired protein synthesis, which was reflected in lower AHA incorporation (Fig. 10b, e), and a reduced density of dendritic spines (Fig. 10c, f). This reduction was specifically caused by the Atl1 mutation because expression of WT Atl1 did not impair ER distribution or protein synthesis. In fact, we even found an increase in dendritic spine density for ATL1 WT (Fig. 10a–f). Thus, these results suggest a role for ATL1 in the regulation of ER distribution, protein synthesis and dendritic spinogenesis.

Image

( a - c, h ) Rat cultured hippocampal neurons were transfected with plasmids, as indicated, and subjected to analyses of ( a ) ER morphology, ( b, h ) protein synthesis based on AHA labeling and ( c ) neuronal morphology using GFP signals. Transfected neurons are indicated either by arrowheads or yellow outline. ER signals in ( a ) were processed with the Surpass Mode of the Imaris software (Bitplane). ( d ) Quantification of the D/S ratio of DsRed-ER. ( e, i ) Relative intensities of AHA-Alexa fluor 488 in soma. ( f ) Quantitation of dendritic protrusion densities. ( g ) Co-immunoprecipiation of VCP and ATL1 from transfected COS-1 cells. Full-size images are available in Supplementary Fig. 9. ( jm ) GFP-actin was cotransfected with various plasmids into cultured neurons as indicated to analyze the density of dendritic spines. ( j ) Atl1 expression partially rescued the effect of Vcp knockdown. ( k ) The ATL1 R217Q mutant and VCP R95G mutant did not have an additive effect on dendritic spine density. ( l ) Expression of the RAB10 T23N mutant further reduced the density of dendritic spines in VCP R95G-expressing cells. ( m ) Extra leucine increased the dendritic spine density of ATL1 R217Q mutant-expressing neurons. Scale bar: ( ac, h ) 20 μm. The data from three independent experiments are presented as the mean+sem (error bars). Cumulative probability distributions of spine density are also shown. The sample sizes ( n ) are indicated. ** P <0, 01; *** P <0, 001; NS, non-significant. One-way ANOVA ( d, e, f ); two-way ANOVA ( im ).

Obrázok v plnej veľkosti

The small GTPase RAB10 also regulates tubular ER formation. However, it is involved in ER tubule growth independently of ATL1 (ref. 48). To examine whether RAB10 also influences protein synthesis and dendritic spine formation, the effects of WT and a GDP-locked T23N mutant of RAB10 in cultured hippocampal neurons were compared. The RAB10 T23N mutant had been shown to inhibit the function of endogenous RAB10 in tubular ER formation 48 . As expected, inhibition of endogenous RAB10 activity by expression of the RAB10 T23N mutant impaired the ER distribution in neurons (Supplementary Fig. 8a, d). Although the mechanisms underlying the function of ATL1 and RAB10 in ER formation differ 48, we found that similar to ATL1, the RAB10 T23N mutant also reduced protein synthesis and dendritic spine formation (Supplementary Fig. 8b, c, e, f). Together, the ATL1 and RAB10 results echo our hypothesis that regulation of the tubular ER network controls protein synthesis and consequently influences the density of dendritic spines.

VCP and ATL1 act together for dendritic spine formation

A recent study indicated that, in Drosophila, VCP functionally interacts with ATL1 (ref. 49). It seems very likely that VCP and ATL1 also work together in mammalian neurons to regulate dendritic spinogenesis. To examine this possibility, we first confirmed the interaction between VCP and ATL1 in mammalian cells by co-immunoprecipitation (Fig. 10g). The rescue effect of overexpression of Atl1 on Vcp knockdown was then investigated. We found that Atl1 overexpression increased protein synthesis and partially rescued the density of dendritic spines in Vcp knockdown neurons (Fig. 10h–j). Expression of both VCP R95G and ATL1 R217Q mutants in cultured neurons did not have an additive effect on downregulation of dendritic spine formation (Fig. 10k). These results suggest that VCP and ATL1 act in the same pathway to control dendritic spine formation. In contrast to ATL1, expression of the RAB10 T23N mutant further decreased the dendritic spine density in the presence of the VCP R95G mutant (Fig. 10l). These results lend further credence to our hypothesis that VCP and ATL1, but not RAB10, work in the same pathway to regulate dendritic spine formation.

To investigate the involvement of protein synthesis in the effect of ATL1 on dendritic spine formation, extra leucine was added to neurons expressing the ATL1 R217Q mutant. Similar to Vcp -deficient neurons, extra leucine also ameliorated the dendritic spine defect caused by the ATL1 R217Q mutant (Fig. 10m).

Since ATL1 is a well-known regulator for tubular ER formation, the physical and functional interactions between VCP and ATL1 further support that VCP controls tubular ER formation to regulate dendritic spine formation.

diskusia

VCP is involved in multiple cellular processes. The current model of the pathogenic mechanism of VCP-related disorders mainly focuses on protein degradation involving UPS, ERAD and autophagy 9, 50 . One of the reasons why protein degradation is particularly interesting is because protein aggregation in patient tissues has been recognized as a hallmark of VCP-related disorders 24, 51 . However, the evidence does not exclude the involvement of other functions of VCP in the pathogenic mechanism(s) of diseases. Previous studies have suggested that the influence of VCP mutations on different types of cells varies. In mouse myoblast C2C12 cells, expression of the VCP IBMPFD mutants induces the aggregation of polyubiquitinated proteins 52 . In contrast, although the VCP IBMPFD mutant proteins do not form obvious aggregates in cultured hippocampal neurons after expression for six days, dendritic spine density was reduced 28, suggesting that protein aggregation is not required for the VCP IBMPFD mutant-mediated impairment of dendritic spinogenesis. These findings imply that the pathogenic mechanisms underlying the VCP defects in different tissues may vary.

In this report, we unexpectedly found that the ER is the critical target of Vcp deficiency in regulating dendritic spine density in neurons. Our data suggest that VCP, P47 and ATL1 work together to control tubular ER formation and influence protein synthesis. Previous studies have suggested that the VCP/P47 complex regulates the activity of an unknown membrane fusion regulator, thereby controlling tubular ER formation 53 . Based on our data, it seems possible that ATL1 is the membrane fusion regulator of the VCP-P47 complex that regulates ER membrane fusion. In our TEM analysis, we found that the length of rER, ribosomal attachment on rER and rER abundance were noticeably reduced in VCP R95G knockin neurons. Although rER is generally believed to contribute to synthesis of membrane/secreted proteins, several studies have demonstrated that a noticeable fraction of cytosolic proteins are also synthesized by ribosomes associated with ER 33, 34, 35 . Thus, ER defects caused by Vcp deficiency likely results in a protein synthesis deficit. Using 1-h AHA labeling, we show here that protein synthesis efficiency is impaired by a Vcp deficiency, which is consistent with the ER defects revealed by TEM. Further, expression of synaptic glutamate receptors GRIN2B and GRIA2/3-the important ion channels of excitatory synapses-was reduced in VCP R95G knockin mutant neurons, indicative of VCP involvement in the impairment of the synaptic response and consequent elimination of dendritic spines. It would be intriguing to explore in the future whether the VCP R95G mutation results in impairment of electrophysiological responses and cognitive deficiencies using our knockin mutant mice.

In our experiments, we did find an unfolded protein response induced by Ufd1l knockdown and tunicamycin treatment. However, the dendritic spine density was not affected by Ufd1l knockdown or tunicamycin treatment, suggesting that an unfolded protein response is not involved in regulation of dendritic spine density. It is noteworthy that protein translation was transiently suppressed by tunicamycin treatment in neurons. Perhaps protein translation suppression is too transient to noticeably influence the total amounts of synaptic membrane proteins, thereby explaining the lack of effect on dendritic spines. Although an unfolded protein response, either induced by Ufd1l knockdown or tunicamycin treatment, seems not to be critical for regulation of dendritic spine density under our experimental conditions, it is still possible that an unfolded protein response influences other neuronal functions. This would be a topic worth pursuing in the future. In addition to protein degradation, the VCP–UFD1L–NPL4 complex also regulates other activities, such as the ubiquitin-governed DNA damage response 54 . As DNA double-stranded breaks are involved in expression of neuronal early-response genes 55, it would also be intriguing to investigate whether VCP contributes to regulation of neuronal early response genes. It may not directly control dendritic spine formation but likely regulates other neuronal functions.

In this report, we provide evidence that changes in ER structure and function may be a common characteristic of various neurological disorders, including IBMPFD and SPG3A. SPG3A is characterized by progressive motor weakness and spasticity 56 . Degeneration of corticospinal tract axons with the onset of childhood is the major phenotypic feature of SPG3A. In addition, recent studies have also indicated hypometabolism in the frontal cortex and cerebellum and functional disorders in the frontal cortex in patients with SPG3A 57, 58 . Our data indicate that expression of the ATL1 mutant reduces the efficiencies of protein synthesis and dendritic spine formation in cultured hippocampal neurons. It seems likely that protein synthesis is also involved in the pathogenesis of SPG3A.

Branched-chain amino acids, particularly leucine, have been shown to bind sestrin2 to activate protein synthesis through the activation of the mTOR pathway in a variety of cells, including neurons 42, 59 . Our data show that restoring protein synthesis using a leucine supplement efficiently increases the activity of S6 kinase, protein synthesis and the dendritic spine density of neurons. In contrast, a recent study indicated that leucine is a less efficient mTOR activator in Vcp -deficient muscle cells 60 . This is another example of a preferential effect of VCP on different cell types. Based on our observations, neurons are susceptible to leucine supplements, so taking a leucine supplement may be a good way of increasing protein synthesis in the brain.

In conclusion, our present study reveals that ER morphogenesis and protein synthesis play roles in dendritic spine formation. VCP, P47 and ATL1 regulate tubular ER formation, influence protein synthesis and then control dendritic spine formation. In light of these findings, we propose that, in addition to unfolded protein accumulation and aggregation, the role of ER morphology and protein synthesis in controlling protein homeostasis should be evaluated in neurological disorders. Restoring protein synthesis with leucine provides a potential therapeutic strategy.

metódy

Protilátky a chemikálie

The antibodies and reagents used in this study were as follows: eIF2 α (ref. 61) (sc-133, 132, mouse, 1:1, 000), Santa Cruz Biotechnology; VCP (612, 182, mouse, 1:1, 000), BD Transduction Laboratories; AHA (C10102), reaction buffer kits (C10269 and C10276), detection reagent Alexa Fluor 488 (A10267), GFP (A6455, rabbit, 1:1, 000), Invitrogen; TAMRA (MA1-041, mouse, 1:1, 000), P47 (PA5-21633, rabbit, 1:500), Calreticulin (PA3-900, rabbit, 1:200) and phospho-eIF2 α (MA5-15133, rabbit, 1:1, 000), Thermo; HA (3F10, rat, 1:500), Roche; MYC (9B11, mouse, 1:1, 000), Phospho-S6 ribosomal protein (4856, rabbit, 1:1, 000), S6 ribosomal protein (2217, rabbit, 1:1, 000), Cell Signaling; GFP (ref. 62) (ab13970, chicken, 1:5, 000), Abcam; puromycin (12D10, mouse, 1:1, 000), GRIN2A (NR2A, 06-313, rabbit, 1:1, 000) (ref. 63), GRIN2B (NR2B, 06-600, rabbit, 1:1, 000) (ref. 63), GRIA1 (GluR1, MAB2263, mouse, 1:1, 000), GRIA2/3 (GluR2/3, 07-598, rabbit, 1:1, 000), GRM5 (mGluR5, AB5675, rabbit, 1:1, 000), PSD-95 (MABN68, mouse, 1:2, 000), Millipore; beta-actin (AC-74, mouse, 1:5, 000), Sigma-Aldrich; CASK (mouse, 1:500) (ref. 64), rabbit polyclonal UFD1L (generated by immunization with full-length mouse UFD1L protein, 1:1, 000); L-leucine, tunicamycin, cycloheximide and CGP57380 (Sigma-Aldrich); Rapamycin (LC Laboratories). The antibodies with validation profiles in Antibodypedia or 1DegreeBio are underlined.

plazmidy

Vcp expression and knockdown plasmids have been described 28 . For the Vcp knockdown experiment, a plasmid cDNA6.2-GW/EmGFP-neg control, which expresses a miRNA that was predicted to not target any gene in mammalian genomes, was used as the non-silencing control in the knockdown experiments. Ub G76V -GFPref. 65 was obtained from Addgene (plasmid number 11941). Rat P47 was amplified by RT-PCR with a pair of primers: forward, 5′- agatctGCGGAGGAGCGGCAGGACGCG -3′; backward, 5′- agatctTTATGTTAACCGCTGCACGA -3′. The PCR product was subcloned into BglII-linearized HA-Gw1-2b vector. Then, the P47 fragment was further purified from HA- P47 plasmid by KpnI and EcoRI and subcloned into KpnI and EcoRI-linearized Myc-Gw1-2b vector. For the P47 knockdown construct P47i, a pair of oligonucleotides (5′- gatccccTGGTGACCTTAGAAGCTACttcaagagaGTAGCTTCTAAGGTCACCAttttta -3′ and 5′- agcttaaaaaTGGTGACCTTAGAAGCTACtctcttgaaGTAGCTTCTAAGGTCACCAggg -3′, the P47 sequence is underlined) were annealed and subcloned into vector pSUPER.neo+GFP (SNG) (Oligoengine) according to the manufacturer's instructions. The vector SNG was then used as a non-silencing control for P47 knockdown experiments. For the P47 silent mutant that is resistant to P47i, the N- and C-terminal fragments P47-N and P47-C were individually amplified by PCR using the primer pairs: P47-N, SP6 and P47mut N primer 5′- TGGagatctCAGAAGCTAC -3′; P47-C, P47mut C primer 5′- GTAGCTTCTGagatctCCA -3′ and T7 primer (mutated nucleotides that did not influence the peptide sequence are underlined, lowercase characters indicate the BglII site). The PCR products were then digested with BglII/XmaI or SalI. Three-piece ligation was then performed to subclone the P47-N and P47-C fragments into XmaI-SalI linearized Gw1-Myc2b. Mouse Atl1 was amplified by PCR with a primer set: 5′- gaagatctATGGCTAAGAGCCGCAGGGA -3′ and 5′- acgcgtcgacTTAAATTTTCTTCTTTTCCG -3′. The recognition sites of BglII and SalI are underlined. The amplified products were subcloned into the Gw1-Myc2b vector. The R217Q mutant was generated by site directed mutagenesis with a primer set: 5′- CTGATATTTCTTGTTCaAGACTGGAGTTTCCCA -3′ and 5′- TGGGAAACTCCAGTCTtGAACAAGAAATATCAG -3′. The lowercase characters represent the single nucleotide mutation sites. Mouse Rab10 was amplified by PCR with a primer set: 5′- gaagatctATGGCGAAGAAGACGTACGA -3′ and 5′- acgcgtcgacTCAGCAGCACTTGCTCTTCC -3′. The underlined nucleotides represent the recognition sites of BglII and SalI. The amplified products were also subcloned into the Gw1-Myc2b vector. The T23N mutant was generated by site directed mutagenesis with the primer set: 5′- TCGGGAGTGGGCAAGAaCTGCGTCCTTTTTCGT -3′ and 5′- ACGAAAAAGGACGCAGtTCTTGCCCACTCCCGA -3′. The lowercase characters indicate the mutated residues. Ub-CD3δ-GFP was constructed by amplifying CD3δ by PCR from mouse spleen cDNA using primers 5′- cggggtaccATGGAACACAGCGGGATT -3′ and 3′- gcgggatccCAGATTTCTTGTTCCGGGG -5′, followed by subcloning into KpnI and BamHI linearized pEGFP-N2 vector. DsRed-ER (Cat. no. 6982-1) was purchased from Clontech. For in utero electroporation, Vcp knockdown and non-silencing control fragments were subcloned into pCAGIG (Addgene, no. 11159) vector at EcoRI site. The GFP fragment of the pCAG-GFP (Addgene, no. 11150) vector was removed by KpnI and NotI digestion, followed by Klenow fill-in and blunt end ligation. DsRed-ER fragments and full-length P47 fragments were then individually subcloned into EcoRI linearized pCAG vector to generate pCAG-DsRed-ER and pCAG-myc-P47.

Bunková línia

COS-1 cells were originally obtained from the Bioresource Collection and Research Center, Taiwan. The transfection protocol with Lipo2000 reagent (Invitrogen) was as described previously 28 . Briefly, a mixture containing 0.8 μg DNA and 4 μl Lipo2000 was added into each well of 12-well culture plate to deliver DNA into COS cells based on manufacture instruction.

zver

All animal experiments were performed with the approval of the Academia Sinica Institutional Animal Care and Utilization Committee and in strict accordance with its guidelines and those of the Council of Agriculture Guidebook for the Care and Use of Laboratory Animals. Animals were housed in the animal facility of the Institute of Molecular Biology, Academia Sinica, with a 14 h light/10 h dark cycle and controlled temperature and humidity. SD pregnant rats and C57BL/6 pregnant mice at embryonic day 18 (E18) were used to prepare cultured hippocampal and cortical neurons. For in utero electroporation, CD1 (ICR) pregnant mice at E15.5 were used. Electroporated pups regardless of gender were analyzed at postnatal day 3 (P3).

Neuronal culture and analyses

The detailed procedures for preparation and calcium phosphate precipitation of rat and mouse hippocampal cultures and the indirect fluorescence immunostaining have been previously described 28, 29, 66 . Briefly, hippocampal neurons from E18.5 embryos were seeded on coverslips (18 mm in diameter and 0.12–0.17 mm in thickness) coated with poly- L -lysine. Calcium phosphate precipitation was carried out using Hepes buffered saline at pH 7.05–7.07. A total 2.5 μg DNA was used for two wells. Neurons were then fixed with phosphate buffered saline (PBS) containing 4% paraformaldehyde and 4% sucrose and permeabilized with PBS with 0.2% Triton-X-100. A PBS solution containing 3% bovine serum albumin was used for blocking and antibody incubation for immunofluorescence staining. Images of neurons were recorded with a confocal microscope (LSM700, Zeiss) equipped with a Plan-Apochromat 63 × NA 1.4 oil objective lens (Zeiss) and captured with Zen acquisition and analysis software (Zeiss) at 20–22 °C as a Z-series of 5–12 sections spaced 0.6–0.8 μm apart. The Z-series was then projected into single images. For publication, the images were processed with Photoshop (Adobe), with minimal adjustment of brightness to the whole images. To analyze dendritic spine density, the spine numbers of dendrite fragments of 20 μm in length starting from a point 20 μm away from the soma were manually counted using ImageJ software. As dendritic spine formation is highly sensitive to culture conditions, such as the quality of the B27 supplement 67, each experiment was repeated using the same lot of culture medium. The data from independent experiments were pooled for statistical analysis only when the variation of the control group was not significantly different between repeated experiments. To minimize the effects of bias, the critical experiments were performed blind by relabeling the samples with the assistance of other lab members.

ER distribution

Cultured neurons were cotransfected with DsRed-ER and the various plasmids as indicated in each experiment. Immunostaining with corresponding antibodies to monitor expression of transfected genes was then performed. Cell images were acquired using a confocal microscope (LSM700, Zeiss) equipped with a Plan-Apochromat 63 × NA 1.4 oil objective lens (Zeiss) and driven by Zen acquisition and analysis software (Zeiss) at 20–22 °C as a Z-series spaced 0.36 μm apart. The Z-series was then projected into a single image to quantify the ER intensities. Neuronal morphology was first outlined based on Myc tag (WT and R95G of VCP) or GFP (control vector, VCPi and P47i) signals using the 'Segmented Line' tool of ImageJ software. The intensities of DsRed-ER in the entire cell and soma were then quantified using the ImageJ measurement tool. Total dendritic DsRed-ER signals were then obtained by subtracting the soma intensities from the whole cell intensities. The ratio of the dendritic signal to somatic signal indicates the dendritic distribution of the ER. To further analyze the ER distribution along dendrites, cumulative probability was also measured. Radius areas were plotted from the soma margin every 5 μm up to a distance of 60 μm away from the soma. The cumulative probability distribution of the ratio of each radius intensity to total dendritic intensities is shown. In addition to ImageJ, quantification was also conducted with the Imaris software package (BitPlane, MN, USA). For this, only one panel of triplicates was verified. The Z-series were processed with the 'Surface Creation' function of Imaris for the DsRed-ER channel. The surface was created by the absolute intensity without filtering. To define the ER signals of the entire neuron, a threshold range (between 18–255 shades/levels of grey) was used to include ER signals in the somata and all dendritic branches. Soma intensities were then quantified by the 'Segment of Interest Regions' tool to outline the soma area with the same threshold. Background surface intensities were manually deleted. The intensity results were then exported to excel for statistical analyses with GraphPad Prism. The representative images were outputted to a TIFF file by a 'snapshot' of the scene. Images were then processed with photoshop for publication. For dsRed2-ER and calreticulin morphology in neurons, super-resolution microscopy and 3D-reconstruction was performed using an Elyra PS.1 microscope (Carl Zeiss) equipped with 63 × /NA 1.4 oil (Plan-Apochromat; Carl Zeiss) objective lens and iXon 885 EMCCD (Andor Technology) at room temperature. The Z-series spaced 0.13 μm apart was set and processed with Zen 2011 software: noise filter parameter value, -3; and SR frequency weighting value, +1.

In utero electroporation and immunohistochemistry

Expression plasmids were delivered to ventricular radial glial cells by electroporation as described 68 . Briefly, at E15.5, pregnant ICR (CD1) mice purchased from BioLASCO (Taiwan) were anesthetized with a MATRX isoflurane VIP 3000 vaporizer (Midmark). One μg μl −1 of DNA plasmid mixture (with 0.01% fast-green dye) in 0.9% NaCl was then injected in the ventricles. Five pulses of 40 mV, 50 ms with 950 ms intervals were generated using Electro Square Porator ECM830 (BTX). Brain sections were then prepared from P3 pups regardless of gender for immunofluorescence staining as described 69 . Briefly, the procedure was similar to the method described in above 'Neuronal Culture and Analysis', except that 30-μm-think sections and 3% normal horse serum in Tris-buffered saline for blocking and antibody incubation were used. Images were collected and analyzed as described above.

VCP R95G knockin mice

A recombineering-based method was used to generate knockin mutant mice 70 . Briefly, a genomic fragment covering from intron 1 to intron 4 of the Vcp gene was subcloned from bacterial artificial chromosome clone RP23-343E15 into a modified pBluescript vector. The R95G point mutation at the third exon and an Eco RV site in the third intron were generated by direct mutagenesis. The lox P-flanked Neo cassette was then introduced into the third intron following the edited Eco RV site (Fig. 4a). The targeting vector was electroporated into C57BL/6 embryonic stem cells for production of chimeric mice. Breeding with C57BL/6-C2J albino strains was performed to accelerate germline transmission. Genotyping was examined by three methods: (1) Genomic Southern blotting was performed using a 5′ probe (nucleotide residues 106, 884–107, 133 of clone RP23-343E15) and 3′ probe (nucleotide residues nucleotide residues 106, 884–107, 133 of clone RP23-343E15), respectively. (2) Genomic PCR was carried out using primer set 1: 5′- GTGTCTGAAGACAGTGGACAGTGT -3′, 5′- GAAGAGCTTGGCGGCGAATG -3′ and 5′- CTTAGAAATGAGACCAGAACCGGG -3′ (Fig. 4a). (3) After removing the Neo cassette by breeding with E2A-Cre mice (stock no. 003724, Jackson lab), offspring were genotyped using primer set 2: 5′- TCAGTGACCCAAAGTCCTTAGC -3′ and GGGAGACGGTGTCTATAATGCAGA -3′. Since the VCP R95G allele contains an edited Eco RV site, the PCR amplified product was further processed with Eco RV digestion (FastDigest, Thermo Scientific) to generate two fragments of comparable size. Sequencing was performed to confirm the specific mutated residues.

Transmisná elektrónová mikroskopia

For transmission electron microscopy (TEM) study, cortical neurons were plated on Aclar embedding film (Electron Microscopy Sciences). At 10 DIV, cells were fixed with fixative buffer (2.5% glutaraldehyde in 0.1 M sodium cacodylate, pH 7.4) for 1 h at 4 °C. After washing with washing buffer (0.1 M sodium cacodylate (Sigma), 4% sucrose, 0.05% CaCl 2 ) for 5 min, cells were post-fixed with 1% OsO 4 (Electron Microscopy Sciences) in 0.1 M sodium cacodylate for 1 h at 4 °C, washed with cold ddH 2 O, for 5 min three times, and incubated in 1% uranyl acid (Polysciences) for 1 h at 4 °C. The samples were then dehydrated with graded ethanol solutions at RT for 7 min for each step: 50% once, 70% once, 90% once and 100% three times. Then, cells were filtrated with a series of solutions as follows: (1) EtOH:Spurr's Resin (Low Viscosity Embedding Media Spurr's, Kit Electron Microscopy Sciences, Hatfield, PA)=1:1 for 30 min; (2) EtOH:Spurr's Resin=1:2 for 40 min; (3) pure Spurr's Resin for 1 h. Cells were then polymerized at 70 °C for 20 h. Ultrathin sections were sectioned with a diamond knife (DiATOME) and stained with 4% uranyl acid for 5 min followed by lead citrate stain for 8 min. After washing with ddH 2 O, cells were examined by TEM (Tecnai G2 Spirit TWIN, FEI Company) with a Gatan CCD Camera (794.10.BP2 MultiScanTM) and acquisition software DigitalMicrograph (Gatan).

De novo protein synthesis monitored by BONCAT and SUnSET

For BONCAT 30, cells were washed with PBS once, then incubated with Met-free DMEM (GIBCO, Invitrogen) for 30 min. L -azidohomoalanine (AHA, 50 μM) was added into the medium for incubation for another 1 h. Cells were then washed with PBS three times and fixed with 4% paraformaldehyde for 15 min. Permeabilization was then performed with 0.2% Triton X-100 for 10 min. After washing with PBS 3 times and blocking with 3% BSA, cells were processed with Click-iT Cell Reaction Buffer Kit (Invitrogen) according to the manufacturer's instructions. Briefly, cells were incubated with Click-iT reaction buffer (5 μM alkyne modified Alexa Fluor-488) for 30 min. To identify transfected neurons, cells were further washed with PBS three times, blocked with 3% BSA again and subjected to standard fluorescence immunostaining with Myc antibody and Alexa Flour-555-conjugated secondary antibody. Alexa Fluor-488 intensities (indicative of AHA incorporation) in the soma and dendrites (a 20 μm fragment 20 μm apart from the soma of transfected neurons) were analyzed using ImageJ. Some of the critical experiments were performed blind to minimize the effects of bias.

For SUnSET 36, cells were transferred to neuronal medium containing puromycin (10 μg ml −1 ) for 10 min. Cells were then washed with PBS three times and returned to the original medium for another 50 min incubation. Fixation and permeabilization were then performed as described above.

Imunoprecipitácia

COS-1 cells were transfected with myc-tagged Atl1 and HA-tagged Vcp for 24 h. Cells were harvested with lysis buffer (50 mM Tris, pH7.4 containing 1% Triton X-100, 2 μg ml −1 leupeptin, 2 μg ml −1 aprotinin, 10 μg ml −1 pepstatin, and 2 mM PMSF, 2 μM MG132) and centrifuged at 12, 000 rpm at 4 °C. The solubilized extract was subjected to immunoprecipitation using Myc antibodies and control non-immune IgG combined with protein A sepharose. After mixing by rotation for 4 h at 4 °C, the precipitates were sequentially washed with the following solutions buffered with 10 mM Tris-HCl (pH7.4): 1% Triton X-100, once; 0.1% Triton X-100 and 0.5 M LiCl, twice; 0.5 M LiCl, once; and Tris buffer alone, once. The precipitated proteins were then analyzed by immunoblotting.

imunoblotu

To detect phosphorylated proteins, sodium fluoride (50 mM), sodium orthovanadate (1 mM) and sodium butyrate (1 mM) were included in lysis buffer (2% SDS in 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 2 μg ml −1 aprotinin, 2 mM PMSF, 2 μg ml −1 leupeptin, 2 μg ml −1 pepstatin, 2 μM MG132, 250 U of Benzonase endonuclease) to lyse cells. Proteins were separated by SDS-PAGE and blotted on PVDF membranes. The membranes were blocked with 5% nonfat milk or 3% BSA in TBS-T (50 mM Tris, pH7.4, 150 mM NaCl with 0.2% Tween 20) for 1 h at RT and incubated with indicated antibodies in 3% blocking solution for 2 h. After washing with TBS-T buffer three times, membranes were incubated with HRP-conjugated secondary antibodies for 1 h. For AHA incorporation, after washing with PBS three times, cells were harvested with lysis buffer (1% SDS in 50 mM Tris-HCl, pH 8.0 buffer with protease inhibitors and endonuclease as described above). Based on the Click-iT Protein Reaction Buffer Kit protocol (Invitrogen), each 100 μg of protein samples was then labeled with 40 μM alkyne modified tetramethylrhodamine (TAMRA). Protein samples were then subjected to immunoblotting as described above, except that anti-TAMRA antibody was used as primary antibody to detect AHA-labeled proteins. For SUnSET, anti-puromycin antibody was used. The antibody-bound complexes were detected with WesternBright Sirius HRP substrate (Advansta). The protein signals were then visualized and analyzed using ImageQuant LAS 4, 000 with the software ImageQuant LAS 4, 000 Biomolecular Imager (GE Healthcare). Images have been cropped for presentation. Full-size images are presented in Supplementary Fig. 9.

Štatistická analýza

All the quantitative data in this report are presented as means plus sem or cumulative distribution. Graphs were plotted using GraphPad Prism 5.0 (GraphPad software). No statistical method was applied to evaluate the sample size, but our sample sizes are similar to a previous publication 28, 68, 69 . Basically, 20–30 neurons were collected each time from three independent experiments. For dendritic spine analysis, three dendrites of each neuron were quantitated. Data collection and analysis were conducted randomly and blind. Most of the data meet the assumption of the tests (normal distribution), except the dendritic spine density. Statistical analysis was performed using the two-tailed unpaired Student t -test for two group comparisons. For three group comparisons, one-way analysis of variance with Bonferroni's test in GraphPad Prism 5.0 was used. Two-way ANOVA with Bonferroni's test using SigmaStat 3.5 was performed to analyze the effects of two genetic factors combined with two different treatments. For cumulative probability distributions of spine density, the statistical significance was analyzed with a Kolmogorov-Smirnov test (SPSS software, version 10.0, SPSS, Chicago, Ill). Hodnoty P <0, 05 sa považovali za významné.

Doplnková informácia

Súbory PDF

  1. 1.

    Doplnková informácia

    Supplementary Figures 1-9

Komentáre

Odoslaním komentára súhlasíte s tým, že budete dodržiavať naše zmluvné podmienky a pokyny pre komunitu. Ak zistíte, že je niečo urážlivé alebo nie je v súlade s našimi podmienkami alebo pokynmi, označte ho ako nevhodné.