N-kadherínová cytoplazmatická doména poskytuje rast nezávislý od ukotvenia a stratu kontaktnej inhibície vedecké správy

N-kadherínová cytoplazmatická doména poskytuje rast nezávislý od ukotvenia a stratu kontaktnej inhibície vedecké správy

Anonim

predmety

  • Prilepí križovatky
  • Signalizácia HIPPO

abstraktné

Rast nádoru je charakterizovaný nezávislosťou od ukotvenia a stratou kontaktnej inhibície. Predtým sme ukázali, že buď červený fluorescenčný proteín (DsRed) -tagged N-kadherínová alebo E-kadherínová cytoplazmatická doména (DNCT alebo DECT) môže fungovať ako dominantný negatívny inhibítor blokovaním lokalizácie endogénneho E-kadherínu na bunkovom povrchu a indukovaním buniek. disociácia. Tu ukazujeme, že expresia DNCT zrušila kontaktnú inhibíciu proliferácie a poskytla rast nezávislý od ukotvenia. Expresia DNCT indukovala premiestnenie nádorového supresora Merlin z povrchu bunky do vnútrobunkových kompartmentov. Hoci expresia DNCT indukovala redistribúciu TAZ z cytoplazmy do jadra, signalizácia YAP / TAZ nebola aktivovaná. Chiméra E-kadherínu-a-katenínu, ktorá funguje ako bunková adhézna molekula nezávislá od β-katenínu, obnovila kontaktnú inhibíciu a závislosť rastu od ukotvenia. Pridanie jadrového lokalizačného signálu T antigénu SV40 zvrátilo účinky expresie DNCT, čo naznačuje, že DNCT fungovala mimo jadra.

úvod

Kadheríny obsahujú veľkú rodinu adhéznych molekúl bunkových buniek závislých od Ca 2+ . Prostredníctvom svojich cytoplazmatických domén interagujú priamo s P-katenínom. a-Catenin interaguje s kadherínmi nepriamo prostredníctvom interakcií s β-katenínom a spája komplex kadherín - katenín s aktínovým cytoskeletom prostredníctvom interakcií s α-aktinínom, vinkulínom a aktínovými vláknami 1 . Keď sa cytoplazmatická doména kadherínov spojila priamo s a-katenínom technikou genetického inžinierstva s použitím cDNA týchto proteínov, chimérické proteíny sprostredkovávajú silnú adhéziu nezávislú od p-katenínu 2 . P-Catenin tiež hrá ústrednú úlohu v signálnej dráhe Wnt. Aktivácia ß-katenínovej dráhy pomocou Wnt vedie k akumulácii cytoplazmatickej zásoby ß-katenínu, ktorá sa potom translokuje do jadra a viaže sa na transkripčné faktory faktora 1 na zvyšovanie lymfocytov (LEF-1) / T-bunkový faktor. (TCF) rodina na reguláciu expresie génov závislých od ß-katenínu-LEF, ako je napríklad cyklín D1 a c-myc 3, 4 . Dysregulácia Wnt / ß-katenínu vedie k konštitutívne stabilnému a aktívnemu β-katenínu a indukuje aberantnú bunkovú proliferáciu a malígnu transformáciu 5 .

Zvyšujúca sa hustota buniek zastavuje proliferáciu epitelových buniek procesom nazývaným kontaktná inhibícia. Pomocou buniek MDCK sa ukázalo, že bunky s nízkou hustotou sa množia a majú vyššie hladiny fosfo-ERK1 / 2 a cyklínu Dl, a že bunky s vysokou hustotou kontaktované inhibujú nízku hladinu týchto proteínov 6 . Trypsinizácia kontaktom inhibovaných buniek MDCK s vysokou hustotou okamžite zvyšuje hladinu fosfo-ERK1 / 2 a nasleduje prechodné zvýšenie hladín D1 cyklínu. Reformácia bunkových spojení po trypsinizácii vedie k zníženiu hladín fosfo-ERK1 / 2 a cyklínu D1. Tieto výsledky naznačujú, že v MDCK bunkách dochádza ku kontaktnej inhibícii proliferácie buniek reguláciou fosforylácie ERK1 / 2 závislou od hustoty buniek. Pretože trypsinizácia buniek narúša E-kadherín, a teda E-kadherínom sprostredkovaná adhézia buniek-buniek, predpokladá sa, že E-kadherín zohráva pri kontaktnej inhibícii rozhodujúcu úlohu.

Prežitie normálnych epitelových buniek závisí od ich interakcií s extracelulárnou matricou a keď sú zbavené takýchto interakcií, podstúpia anoikis 7 . Rezistencia na anoikis je spoločnou črtou mnohých rakovín a prispieva k progresii nádoru 8 . Predchádzajúce správy naznačili, že ß-katenínová signalizácia je v regulácii anoikisu. Bolo preukázané, že stabilná nadmerná expresia p-katenínu v MDCK bunkách zvyšuje signalizačnú aktivitu p-katenínu, stimuluje proliferáciu buniek pri vysokých hustotách buniek, podporuje tvorbu kolónií na mäkkom agare a inhibuje anoikis 9 . Expresia β-katenínu v iných bunkách tiež zabraňuje anoikis a aktivuje β-katenín-LEF-responzívny reportérový gén 10 .

Ukázalo sa, že expresia kadherínu divokého typu inhibuje rast buniek SW480 na mäkkom agare. Táto inhibičná aktivita na rast bola mapovaná na väzbové miesto p-katenínu cytoplazmatickej domény 11 kadherínu. Ukázalo sa, že sekvestrácia ß-katenínu nadmernou expresiou kadherínu bráni jeho jadrovej translokácii a inhibuje β-katenínom sprostredkovanú transkripčnú aktivitu 12 . Pretože rozpustné formy cytoplazmatických chvostov N- alebo E-kadherínu majú schopnosť viazať P-katenín, membránovo viazané aj rozpustné formy cytoplazmatických domén kadherínu sú schopné zabrániť signalizácii p-katenínu 13, 14 . E-kadherín okrem toho inhibuje rastovú signalizáciu sprostredkovanú receptorom epidermálneho rastového faktora (EGF) prostredníctvom 15 alebo nezávislých mechanizmov nezávislých od β-katenínu 16 .

Hippo signálna dráha riadi veľkosť orgánu inhibíciou proliferácie buniek a podporovaním apoptózy. Dráha stimuluje jadrové vylúčenie a inaktiváciu transkripčného koaktivátora Áno asociovaného proteínu (YAP) a jeho paralogu TAZ (transkripčný aktivátor s väzbovým motívom PDZ) 17 . YAP sa podieľa na inhibícii kontaktu, pretože jeho fosforylácia a jadrová lokalizácia sú regulované hustotou buniek prostredníctvom signálnej dráhy Hippo 18, 19, 20 . Nadmerná expresia YAP / TAZ stimuluje proliferáciu buniek, znižuje inhibíciu kontaktov s bunkami 21 a indukuje rast nezávislý od ukotvenia v mäkkom agare 22 . Nedávno sa ukázalo, že E-kadherín prostredníctvom signálnej dráhy Hippo priamo sprostredkuje kontaktnú inhibíciu proliferácie riadením YAP subcelulárnej lokalizácie v ľudských MCF10A prsných epitelových bunkách a MDA-MB-231 bunkách 23 . Prechodné zníženie hladín p-katenínu viedlo k zvýšenej jadrovej akumulácii YAP a zníženej fosforylácii YAP pri S127 23 . Štúdie na bunkovej línii ľudských keratinocytov HaCaT však nepodporujú túto úlohu E-kadherínu pri aktivácii Hippo dráhy 24, takže vzťah medzi E-kadherínom a Hippo signalizačnou cestou zostáva nevyriešený.

Predtým sme ukázali, že Discosoma sp. červené cytoplazmatické domény kadherínového fluorescenčného proteínu (DsRed) exprimované v bunkách MDCK interagujú s p-katenínom, znižujú hladiny p-katenínu spojené s endogénnym E-kadherínom a inhibujú lokalizáciu endogénneho E-kadherínu na povrchu bunky, čo vedie k morfologickým zmenám vrátane inhibície tvorby desmozómu a tesných spojov a zníženia mechanickej integrity listov epiteliálnych buniek 25 . Na rozdiel od predchádzajúcich pozorovaní, že expresia kadherínových cytoplazmatických domén inhibovala bunkový rast inhibíciou p-katenínovej signalizácie, zistili sme, že expresia cytoplazmatických domén zvýšila proliferáciu buniek. Podrobná analýza odhalila, že expresia kadherínovej cytoplazmatickej domény spôsobila stratu kontaktnej inhibície proliferácie a prepožičala rezistenciu na anoikis, zatiaľ čo tiež inhibovala signalizáciu p-katenínu a YAP / TAZ. To naznačuje, že tieto signálne dráhy nesprostredkovávajú funkcie DNCT. Naopak, expresia DNCT indukovala premiestnenie nádorového supresora Merlin z povrchu bunky do vnútrobunkových kompartmentov. Pretože Merlin je kritickým regulátorom kontaktne závislej inhibície proliferácie a pre svoju funkciu potláčajúcu rast je potrebná lokalizácia membrány, premiestnenie Merlinu mohlo skutočne hrať úlohu v DNCT aktivite.

výsledok

Expresia cytoplazmatickej domény N-kadherínu zvyšuje proliferáciu buniek

Vytvorili sme chimérický konštrukt (DNCT) obsahujúci fluorescenčný proteín, DsRed, N-kadherínovú cytoplazmatickú doménu (NCT) a C -koncovú FLAG značku 25 . Konštrukt bol exprimovaný pod kontrolou Tet-represorového transaktivátora v MDCK bunkovom klone T23 exprimujúcom tet represor (bunky DNCT +). Ako kontrola sa použil konštrukt DsRed označený FLAG (bunky DsRed +). Bunky exprimujúce kontrolu DsRed rástli v monovrstvových kultúrach ako epitelové zhluky s typickou morfológiou dlažebnej kosti (obrázok la). Naopak, expresia DNCT proteínu spôsobila dramatické zmeny v kultivovaných bunkách, vrátane viacvrstvových buniek, zaokrúhľovania buniek v hornej vrstve a oddelenia sférických buniek z monovrstvy (obr. La). Kultivácia buniek DNCT + v prítomnosti Dox tieto morfologické zmeny úplne zvrátila. Imunoblotová analýza buniek DNCT + T23 kultivovaných 2 dni s doxycyklínom alebo bez doxycyklínu ukázala, že DNCT bola detegovaná v proteínových extraktoch z buniek kultivovaných bez Dox, ale bola významne znížená (~ 10%) v extraktoch z buniek kultivovaných s Dox (obr. 1b). Počas kultivácie buniek DNCT + v neprítomnosti Dox sme pozorovali množstvo plávajúcich buniek (obr. La, stredný panel), čo zvyšuje pravdepodobnosť, že expresia buniek indukuje expresia DNCT. Aby sa to vyriešilo, bunky sa nechali rásť do zhluku v prítomnosti alebo neprítomnosti Dox a spočítali sa bunky vrhané do média. Počet búrok bol značne zvýšený v DNCT + bunkách kultivovaných v neprítomnosti Dox v porovnaní s DNCT + bunkami kultivovanými v prítomnosti Dox (obr. Lc).

Image

Klony vykazujúce tetrepresibilnú expresiu DNCT alebo DsRed boli izolované a označené DNCT + alebo DsRed +. a ) Morfológia buniek po 3 d. Bunky DsRed + rástli v monovrstvových kultúrach ako vrstvy epiteliálnych buniek s typickou morfológiou kostry, zatiaľ čo expresia proteínu DNCT viedla k dramatickým zmenám v bunkových kultúrach DNCT + vrátane viacvrstvových buniek a zaokrúhľovania buniek v hornej vrstve (-Dox). Kultivácia buniek DNCT + v prítomnosti Dox (+ Dox) úplne zvrátila morfologické zmeny vyvolané expresiou DNCT. ( b ) Imunoblotová analýza konfluentných bunkových kultúr odhalila, že p44 / 42 MAP kináza a Akt boli fosforylované (aktivované) v DNCT + (-Dox) bunkách a že fosforylácia klesla po ošetrení Dox (+ Dox). Expresia DNCT tiež zvýšila hladiny cyklínu Dl. Kvantifikácie získané denzitometriou sú uvedené pod príslušnými panelmi. DNCT sa detegoval pomocou anti-FLAG protilátky. Vinculin sa použil ako kontrola plnenia. ( c ) Rast a oddelenie buniek z monovrstvy. Bunky DNCT + sa kultivovali s (+) alebo bez (-) Dox na platniach Transwell a bunky sa preliali do média a spočítali sa na membránach. Hodnoty označujú priemer ± SE; n = 3. Približne 30% buniek sa vrhlo do média počas 3 dní v kultúre. d ) Expresia DNCT zvyšuje počet buniek pozitívnych na Ki-67. Bunky DsRed + alebo DNCT + boli kultivované 2 dni a boli zafarbené anti-Ki-67 protilátkou a DAPI. V kultúrach DNCT +, ale nie DsRed +, došlo k podstatnému zvýšeniu počtu proliferujúcich (Ki-67 – pozitívnych) buniek. Čo sa týka buniek DsRed +, bunky Ki-67-pozitívne boli umiestnené na okraji kolónií. Zníženie expresie DNCT inkubáciou buniek DNCT + v prítomnosti Dox (+ Dox) znížilo počet proliferujúcich buniek a bunky Ki-67-pozitívne sa obmedzili na bunky na periférii. Expresia ELAαC (chiméra E-kadherínu-α-katenínu) v bunkách DNCT + (DNCT + ELAαC) znížila počet Ki-67-pozitívnych buniek, ale expresia ELA (mutantný E-kadherín) v bunkách DNCT + (DNCT + ELA) nemal žiadny účinok. Tyčinky, 25 um.

Obrázok v plnej veľkosti

Na koreláciu týchto pozorovaní s bunkovou proliferáciou sme použili Ki-67 - ktorý je exprimovaný v jadre počas bunkového cyklu, ale chýba v G026 - ako proliferačný marker. Farbenie na Ki-67 odhalilo podstatné zvýšenie počtu proliferujúcich buniek v populáciách DNCT +, ale nie v populáciách DsRed + (Obr. 1d, ľavý dva panely). V prípade populácií DsRed + boli bunky Ki-67-pozitívne umiestnené na okraji kolónií. Zníženie hladín expresie DNCT inkubáciou buniek DNCT + v prítomnosti Dox znížilo počet proliferujúcich buniek a bunky Ki-67-pozitívne v týchto kultúrach sa obmedzili na perifériu kolónií (obrázok 1d, stredný panel). Expresia DNCT v MDCK bunkách teda viedla k strate kontaktnej inhibície proliferácie.

Je známe, že kontaktná inhibícia zahŕňa MAPK a / alebo PI3K / Akt cesty 6, 27 a konfluentné bunky inhibované kontaktom exprimujú nízke hladiny týchto proteínov a tiež cyklínu Dl. Pomocou buniek MDCK sa ukázalo, že bunky s nízkou hustotou sa množia a majú vyššie hladiny fosfo-ERK1 / 2 a cyklínu Dl, a že bunky s vysokou hustotou kontaktované inhibujú nízku hladinu týchto proteínov 6 . Imunoblotová analýza s použitím protilátok zameraných proti fosforylovaným (aktivovaným) ERK1 / 2 a Akt odhalila, že tieto kinázy boli fosforylované v bunkách DNCT + a že fosforylácia sa znížila po ošetrení Dox (obr. 1b). Pretože cyklín D1 je dôležitým prvkom vstupu do bunkového cyklu, skúmali sme hladiny cyklínu D1 a zistili sme, že boli zvýšené v bunkách exprimujúcich DNCT (obrázok 1b).

Expresia DNCT podporuje rast nezávislý od ukotvenia, ktorý vyžaduje MAP kinázu

Zaznamenali sme, že suspenzná kultúra buniek DsRed +, ale nie DNCT +, viedla k bunkovej smrti (obrázok 2a). Tieto nálezy naznačujú, že DNCT môže inhibovať anoikis v dôsledku straty adhézie bunka-substrát. Na testovanie tejto hypotézy sa bunky DsRed + a DNCT + s ošetrením Dox alebo bez neho kultivovali v špecializovaných doskách pre tkanivové kultúry nazývaných PrimeSurface , ktoré bránia prichyteniu buniek. Expresia DNCT, ale nie samotná DsRed, podporovala proliferáciu buniek v podmienkach kultivácie v suspenzii, merané pomocou testu WST-1 (obr. 2b). Avšak zníženie hladín DNCT vyvolané Dox znížilo rýchlosť proliferácie buniek na kontrolné (DsRed +) hladiny. Expresia DNCT v bunkách T23 MDCK bola teda chránená proti anoikis.

Image

( a ) Fázové kontrastné mikrografy buniek kultivovaných na doštičkách s ultranízkou väzbou (PrimeSurface ) na udržanie buniek v suspenzii. Významná časť buniek DsRed + odumiera (tmavé bunky) po 3 dňoch v suspenznej kultúre, ale bunky DNCT + zostávajú životaschopné (svetlé bunky). ( b ) Kvantifikácia životaschopnosti buniek po 5 dňoch v suspenznej kultúre. Bunky exprimujúce DNCT, DsRed, DNCTSA, DNCT a ELA (DNCT + ELA), DNCT a ELAαC chiméra (DNCT + ELAαC) alebo DNCTNLS sa kultivovali v prítomnosti (+) alebo neprítomnosti (-) Dox na normálnych doskách pre tkanivové kultúry ( kontrola) alebo na doštičkách s nízkym pripojením a boli testované na ich životaschopnosť pomocou testu WST-1. Výsledky sú vyjadrené ako percento z hodnôt získaných s pripojenými (kontrolnými) bunkami. Hodnoty označujú priemer ± SE; n = 3. DNCTSA je derivát DNCT nesúci alanínové substitúcie konzervovaných osem zvyškov serínu v väzbovom mieste katenínu, čo oslabuje jeho interakcie s p-katenínom. DNCTNLS je derivát DNCT nesúci signál SV40 NLS na svojom C -konci. c ) bunky sa podrobia anoikis v suspenznej kultúre; Expresia DNCT chránená proti tejto bunkovej smrti. Bunky sa kultivovali na ultratenkých upevňovacích doštičkách počas 3 dní a potom sa farbili FITC-annexinom V. ( d ) DNCT + bunky vykazovali rast nezávislý od ukotvenia. Bunky sa kultivovali na mäkkom agare v prítomnosti (+ Dox) alebo neprítomnosti (-Dox) Dox počas 21 dní. Počet kolónií s priemerom väčším ako 50 μm sa spočítal a je uvedený na spodnej strane obrázkov. Hodnoty označujú priemer ± SE; n = 3. stĺpce, 25 um.

Obrázok v plnej veľkosti

Aby sa potvrdilo, že plávajúce bunky boli podrobené anoikis, boli zafarbené FITC-značeným annexinom V, apoptózovým markerom 28 . Po 3 dňoch v suspenznej kultúre sa väčšina (> 80%) buniek DsRed + s ošetrením Dox alebo bez neho vyfarbila anexínom V (obr. 2c). Väčšina (> 70%) buniek DNCT + s ošetrením Dox sa tiež zafarbila anexínom V. Naopak, menšina (<10%) buniek DNCT + bez ošetrenia Dox sa zafarbila anexínom V. Expresia DNCT teda zvýšila percento životaschopných bunky v suspenzných kultúrach ich ochranou pred anoikis.

Tieto výsledky zvýšili možnosť, že DNCT stimuluje rast buniek nezávislý od ukotvenia. Preto sme skúmali, či expresia DNCT môže sprostredkovať rast buniek na mäkkom agare. Rast buniek DsRed + s ošetrením Dox alebo bez neho a buniek DNCT + s pôsobením Dox bol pomalý a kolónie boli veľmi malé (priemer <50 μm) aj po 21 dňoch kultivácie (obr. 2d). Rast DNCT + buniek v neprítomnosti Dox bol rýchly a kolónie boli omnoho väčšie v porovnaní s DNCT + bunkami ošetrenými Dox.

Expresia DNCT viedla k aktivácii MAP kinázy a Akt signalizácie; tieto signálne dráhy boli zapojené do podpory bunkovej proliferácie a prežitia 29 . Preto sme testovali, či DNCT-sprostredkovaná ochrana proti anoikis bola závislá od týchto signálnych dráh. Ošetrenie PD0325901, účinným inhibítorom kinázy MAP kinázy (MEK), skutočne zrušilo ochranný účinok expresie DNCT na bunky kultivované v suspenzii (obr. 3a), čo naznačuje, že signalizácia MAP kinázy sa podieľa na záchrane buniek pred anoikisom podľa DNCT. Ošetrenie inhibítormi PI3 kinázy, Wortmannin a LY294002, mierne inhibovalo rast buniek v rovnakom teste, zatiaľ čo ošetrenie inými inhibítormi signálnych dráh súvisiacich s proliferáciou buniek významne neovplyvnilo životaschopnosť.

Image

a ) Inhibítor MEK zhoršuje prežitie vyvolané DNCT v suspenzných kultúrach. Test proliferácie sa uskutočňoval v prítomnosti nasledujúcich chemikálií: DMSO (kontrola), PD0325901 (1 μM), Wortmannin (10 μM), LY294002 (25 μM), AKT inhibítor V (30 μM), AKT 1/2 ( 30 μM) a staurosporín (induktor apoptózy; 1 μM). Bunky DNCT + boli kultivované na doštičkách s nízkym pripojením v prítomnosti (+) alebo neprítomnosti (-) Dox. Po 72 hodinách boli bunky testované na životaschopnosť pomocou testu WST-1. Výsledky boli vyjadrené ako percento kontrolných (DMSO) buniek kultivovaných v neprítomnosti Dox (-Dox). Hodnoty predstavujú priemer ± SE; n = 3. ( b ) Hladiny aktivovanej MAP kinázy a cyklínu D1 zostali zvýšené v bunkách DNCT + (-Dox). Bunky sa kultivovali na ultratenkých pripevňovacích platniach (v suspenzii) v prítomnosti (+) alebo neprítomnosti (-) Dox počas 24 hodín. Potom boli bunky pozbierané a extrakty boli analyzované imunoblotom s použitím uvedených protilátok. ( c ) MEK inhibítor PD0325901 blokuje fosforyláciu ERK. Bunky sa kultivovali na ultratenkých pripevňovacích platniach (suspenziách) alebo na normálnych platniach (pripevnených) v prítomnosti (+) alebo neprítomnosti (-) PD0325901 (1 uM) počas 24 hodín. Po zbere buniek boli extrakty analyzované imunoblotovaním s použitím uvedených protilátok. V ( b, c ) sa ako kontrola nanášania použil vinculin.

Obrázok v plnej veľkosti

Pretože sa zdá, že dráha MAP kinázy je zapojená do DNCT-sprostredkovanej ochrany proti anoikis, posúdili sme, či samotná MAP kináza bola aktivovaná expresiou DNCT v suspenzných kultúrach. Bunky DNCT + s Dox alebo bez Dox sa kultivovali 24 hodín na ultra nízko pripevňovacích platniach. Bunky sa zozbierali a lyzáty sa podrobili imunoblokovej analýze s použitím protilátok zameraných proti fosforylovanému ERK1 / 2 a cyklínu Dl. Aj keď sa v bunkách kultivovaných v neprítomnosti Dox detegovalo významné množstvo fosforylovaného ERK1 / 2 a cyklínu Dl, pridanie Dox, ktoré znížilo expresiu DNCT, viedlo k významnému zníženiu hladín fosforylácie ERK1 / 2 a cyklínu D1 ( Obr. 3b). Tieto údaje naznačujú, že expresia DNCT v suspenzných kultúrach vedie k aktivácii MAP kinázy.

Aby sa potvrdilo, že signalizácia MAP kinázy sa podieľa na záchrane buniek z anoikis pomocou DNCT, skúmali sme fosforyláciu ERK v bunkách ošetrených inhibítorom MEK PD0325901. Western bloty odhalili, že predbežné ošetrenie buniek inhibítorom MEK zrušilo aktiváciu ERK (tj fosfo-ERK) (obr. 3c). PD0325901 inhiboval aktiváciu ERK nielen vo vznášajúcich sa bunkách, ale tiež v naviazaných bunkách, hoci mal marginálny účinok na rast pripojených buniek (údaje nie sú uvedené).

Expresia DNCT mení intracelulárnu distribúciu Merlin a TAZ

Merlin hrá dôležitú úlohu pri kontaktnej inhibícii proliferácie 30, 31 . Po kontakte bunka-bunka Merlin interaguje s komplexom kadherín-katenín 32 a zoslabuje následnú signalizáciu z EGFR 30 . Merlin je tiež známy ako upstream regulátor Hippo signálnej dráhy a funguje prostredníctvom YAP / TAZ 33 . Dôležité je, že spojenie s membránou je dôležité pre to, aby Merlin fungoval ako regulátor rastu 34, 35 . Preto sme hodnotili lokalizáciu Merlinu v bunkách DNCT + s Dox alebo bez Dox (Obr. 4a). V prítomnosti Dox, keď sa vytvorili spojenia bunka-bunka, sa Merlin detegoval hlavne na membráne. Naopak, Merlin bol pozorovaný prevažne v cytoplazme v neprítomnosti Dox. Expresia DNCT preto zmenila intracelulárnu lokalizáciu Merlinu. DNCT neovplyvnil množstvo fosfo-Merlinu a Merlinu (Obr. 4b); preto nie je to merlinová fosforylácia v S518, ktorá určovala jeho lokalizáciu. Ďalej sme skúmali membránovú versus cytosolovú distribúciu Merlin, E-kadherínu a P-katenínu v bunkách DNCT + (obr. 4c). V DNCT + boli bunky kultivované v prítomnosti Dox, E-kadherín, P-katenín a Merlin primárne nájdené v membránovej (časticovej) frakcii (Obr. 4c, pravé panely). Keď boli bunky kultivované v neprítomnosti Dox, DNCT bola prítomná ako v cytosolických, tak aj v membránových frakciách (obrázok 4c, ľavý panel). Aj keď expresia DNCT nezmenila distribúciu E-kadherínu a Merlinu, v cytosolovej frakcii bola prítomná významná časť (~ 50%) p-katenínu. Pretože membránová frakcia obsahuje tiež zložky cytoskeletu, vrátane aktínu a vinkulínu, je možné, že DNCT sa môže získať v tejto frakcii z dôvodu jej interakcie s p-katenínom a a-katenínom.

Image

a ) Bunky boli zafarbené pomocou anti-E-kadherínu (E-cad), anti-β-katenínu (β-mačka), anti-α-katenínu (α-mačka) a anti-Merlinových protilátok a phalloidínom na detekovať aktín. Aj keď expresia DNCT viedla k intracelulárnej lokalizácii E-kadherínu, P-katenínu a Merlina, represia expresie DNCT pridaním Dox (+ Dox) viedla k vytvoreniu kadherínových spojení, vrátane kortikálnych aktínových vlákien a membránovej lokalizácie merlin. ( b ) Imunoblotová detekcia Merlin a fosfo-Merlin odhalila, že expresia DNCT nemení množstvo týchto proteínov. Vinculin sa použil ako kontrola plnenia. ( c ) Subcelulárna distribúcia E-kadherínu, DNCT, P-katenínu a Merlínu v bunkách DNCT + kultivovaných 2 dni v prítomnosti (+) alebo neprítomnosti (-) Dox. Bunky DNCT + boli kultivované 2 dni v prítomnosti (+) alebo neprítomnosti (-) Dox. Bunky sa homogenizovali a odstredili, aby sa získali frakcie cytosolových (C) a časticových (M). Každá frakcia bola podrobená imunoblotovej analýze s uvedenými protilátkami. ( d ) Imunofluorescenčné farbenie anti-Merlinovou protilátkou odhalilo spoločnú lokalizáciu Merlinu s DNCT. Naproti tomu Merlin neadralizoval spoločnú lokalizáciu s DsRed alebo s DNCTSA. e ) Merlin koimunoprecipitovaný s DNCT, ale nie s DsRed alebo DNCTSA. Imunoprecipitáty získané s použitím anti-FLAG protilátky na lyzátoch z DsRed +, DNCT + alebo DNCTSA + buniek boli blotované s uvedenými protilátkami. Hviezdička označuje polohu ťažkého reťazca imunoglobulínu. ( f ) Merlin sa neimunoprecipitoval s ELA alebo ELAaC exprudovaným v bunkách DNCT +. HA-značené ELA alebo ELAaC boli zozbierané s použitím anti-HA protilátky z lyzátov DNCT + ELA alebo DNCT + ELAaC buniek a korecipitované materiály boli blotované s uvedenými protilátkami. Tyčinky, 25 um. ( g ) Expresia ELAaC obnovuje intracelulárnu lokalizáciu Merlinu. Bunky boli zafarbené anti-Merlinovými protilátkami. Aj keď expresia ELA nezmenila cytoplazmatickú lokalizáciu Merlinu, výsledkom expresie ELAaC v DNCT + bunkách bola membránová lokalizácia Merlinu.

Obrázok v plnej veľkosti

Predchádzajúce experimenty ukázali, že sa Merlin viaže priamo na a-katenín 32 . Pretože sa DNCT viaže na p-katenín a tvorí komplex s a-katenínom prostredníctvom p-katenínu, je možné, že tvorba komplexu s DNCT zmenila distribúciu Merlinu. Imunofluorescenčné farbenie buniek DNCT + a DsRed + odhalilo, že DNCT, ale nie DsRed, boli čiastočne kolokalizované pomocou Merlin (obr. 4d). Expresia DNCTSA - derivátu DNCT s alanínovými substitúciami konzervovaných ôsmych zvyškov serínu v väzbovom mieste katenínu, ktoré oslabuje interakciu s p-katenínom 25 - neovplyvňovala lokalizáciu membrány Merlin (obr. 4d) a nepodporovala ukotvenie - nezávislý rast buniek (obr. 2b). Imunoprecipitácia lyzátov vyrobených z buniek DNCT + s použitím anti-Flag protilátky nasledovaná imunoblotovou analýzou s anti-Merlin protilátkou odhalila, že Merlin koimunoprecipitoval s DNCT spolu s a-katenínom a P-katenínom (obrázok 4e, ľavé panely). Merlin bol teda súčasťou komplexu DNCT. Rovnaká analýza s bunkami DNCTSA + odhalila, že Merlin koimunoprecipituje s DNCTSA (Obr. 4e, pravé panely).

Signálna dráha hrocha hrá dôležitú úlohu pri kontaktnej inhibícii proliferácie 18, 19, 36 . V riedkych bunkových kultúrach je YAP / TAZ prevažne lokalizovaný v jadre, ale v hustých bunkových kultúrach je fosforylovaný a translokovaný do cytoplazmy. Preto sme skúmali, či lokalizácia TAZ bola ovplyvnená expresiou DNCT. Aj keď bol TAZ vylúčený z jadra a prevažne lokalizovaný v cytoplazme buniek DsRed +, TAZ bol distribuovaný do buniek DNCT +, pričom významná časť bola lokalizovaná v jadre (obrázok 5a). Je zaujímavé, že Dox-indukovaná redukcia expresie DNCT viedla k redistribúcii TAZ z jadra do cytoplazmy. Podobne bola podstatná časť YAP lokalizovaná v jadre (obr. 5b). Doxom indukovaná redukcia expresie DNCT viedla k redistribúcii YAP z jadra do cytoplazmy, hoci časť YAP zostala v jadre. Expresia DNCT neovplyvňovala hladiny TAZ (obr. 5c) ani rastového faktora spojivového tkaniva (CTGF), dobre známeho génového produktu regulovaného YAP / TAZ (obr. 5d). Posledný výsledok naznačuje, že signalizácia TAZ nebola aktivovaná napriek jej jadrovej lokalizácii.

Image

( a ) Imunofluorescenčné farbenie buniek T23 MDCK exprimujúcich DsRed, DNCT alebo DNCT a ELA (DNCT + ELA) alebo DNCT a ELAαC (DNCT + ELAαC). Bunky boli zafarbené anti-TAZ protilátkami a DAPI. Aj keď je TAZ vylúčený z jadra a je prevažne lokalizovaný v cytoplazme buniek DsRed +, TAZ je distribuovaný v bunkách DNCT + vrátane významnej časti v jadre. Doxom indukovaná redukcia expresie DNCT spôsobila redistribúciu TAZ z jadra do cytoplazmy. Expresia ELAaC v bunkách DNCT + bráni jadrovej lokalizácii TAZ indukovanej DNCT. ( b ) farbenie buniek DNCT + anti-YAP protilátkami a DAPI. Bunky sa kultivovali 2 dni v prítomnosti (+) alebo neprítomnosti (-) Dox. Tyčinky, 25 um. ( c, d ) Imunoblotová detekcia TAZ ( c ) a CTGF ( d ) odhalila, že expresia DNCT nemení množstvo týchto proteínov. Vinculin sa použil ako kontrola plnenia.

Obrázok v plnej veľkosti

Expresia DNCT inhibuje YAP / TAZ a p-katenínovú signalizáciu

Aby sme určili, či je aktivita TAZ regulovaná expresiou DNCT, monitorovali sme transkripčnú aktivitu TAZ v bunkách DNCT + kultivovaných s Dox alebo bez Dox. Na tento účel sme použili syntetický reportér EGFP reagujúci na YAP / TAZ (8 × GTIIC-EGFP) ako priame odčítanie aktivity. Podobný konštrukt bol predtým použitý na úspešné monitorovanie aktivity YAP / TAZ závislej na TEAD24. Tento konštrukt bol zavedený do buniek DNCT + a boli izolované stabilné transfektanty. 8 x GTIIC-EGFP / DNCT bunky kultivované v prítomnosti Dox a bez séra vykazovali nízke hladiny expresie EGFP proteínu, ako bolo stanovené prietokovou cytometriou (Obr. 6a, + Dox / -serum). Kyselina lyzofosfatidová (LPA) nedávno preukázala aktiváciu transkripčnej aktivity 37 na YAP / TAZ a pridanie LPA do kultúr zvýšilo expresiu proteínu EGFP (obr. 6a, + Dox / + LPA). Keď sa bunky kultivovali v neprítomnosti Dox, hladiny EGFP sa znížili (Obr. 6a, -Dox / -serum) a aktivita YAP / TAZ sa neaktivovala pridaním LPA (Obr. 6a, -Dox / + LPA). ). V súlade s týmito výsledkami, porovnanie génovej expresie buniek DNCT + kultivovaných s Dox alebo bez Dox pomocou mikročipu Agilent Whole Canine Micro Canray neodhalilo žiadnu zmenu v expresii CTGF (tabuľka S1). Z 112 transkriptov, ktoré boli predtým identifikované ako signifikantne zvýšené nadmernou expresiou YAP v bunkách 19 NIH 3T3, boli štyri upregulované a tri downregulované expresiou DNCT; zvyšok (105 génov) nevykazoval žiadnu zmenu (tabuľka S1 a tabuľka S2). Súhrnne tieto údaje naznačujú, že aj keď expresia DNCT indukovala jadrovú lokalizáciu TAZ a YAP, nestačilo indukovať cieľové expresné gény.

Image

EAPP reportér reagujúci na YAP / TAZ (8 x GTIIC-EGFP) ( a ) alebo p-katenín reagujúci EGFP reportér (TOP-EGFP) ( b ) bol zavedený do buniek DNCT + a boli izolované stabilné transfektanty. Bunky boli kultivované 2 dni v prítomnosti (+) alebo neprítomnosti (-) Dox pred začatím experimentov. Potom sa bunky kultivovali 24 hodín v prítomnosti (+) alebo neprítomnosti (-) LPA (20 μM) alebo BIO (3 μM), aby sa stimulovala transkripčná aktivita YAP / TAZ alebo p-katenínu, a analyzovali sa prietokom cytometrie.

Obrázok v plnej veľkosti

Dráha Wnt / P-katenínu prispieva k samoobnoveniu kmeňových buniek a / alebo progenitorových buniek v rôznych tkanivách 3 . Pretože p-katenín je kritickým hráčom v signálnej ceste 3 Wnt, preukázalo sa, že sekvestrácia p-katenínu kadherínovou cytoplazmatickou doménou bráni jeho jadrovej translokácii a inhibuje transkripčnú aktivitu sprostredkovanú p-katenínom 12, 13, 14 . Inhibícia signalizácie p-katenínu E-kadherínom môže mať za následok potlačenie bunkového rastu, čo poskytuje molekulárny základ pre adhézne nezávislé tumor-supresorové funkcie E-kadherínu 38 . Aj keď naše výsledky nie sú v súlade s podozrením na cytoplazmatickú doménu E- alebo N-kadherínu na dráhe Wnt / β-katenínu, skúmali sme vplyv expresie DNCT na transkripčnú aktivitu β-katenínu. Uskutočnili sme reportérovú analýzu s použitím konštruktu exprimujúceho EGFP pod kontrolou tandemových repetícií väzbového miesta LEF-1 / TCF (TOP-EGFP) 39 . Rovnaký konštrukt sa predtým používal na úspešné monitorovanie aktivity β-katenínu závislej od LEF-1 40 . Konštrukt bol zavedený do buniek DNCT + a boli izolované stabilné transfektanty. Bunky TOP-EGFP / DNCT kultivované v prítomnosti Dox vykazovali nízke hladiny expresie EGFP proteínu, ako bolo stanovené prietokovou cytometriou (Obr. 6b, + Dox / -BIO). BIO (6-brómindirubín-3'-oxím) - ktorý inhibuje GSKp3, kinázu, ktorá fosforyluje a spôsobuje, že β-katenín je náchylný na proteozomálnu degradáciu, a teda stabilizuje β-katenín, aktivuje transkripčnú aktivitu β-katenínu 41 . Pridanie BIO do kultúr zvýšilo expresiu EGFP proteínu (Obr. 6b, + Dox / + BIO). Keď sa bunky kultivovali v neprítomnosti Dox, hladiny expresie EGFP sa znížili (obr. 6b, -Dox / -BIO) a transkripčná aktivita p-katenínu sa neaktivovala pridaním BIO (obr. 6b, -Dox). / + BIO). Tieto údaje naznačujú, že expresia DNCT neaktivovala, ale namiesto toho inhibovala transkripčnú aktivitu sprostredkovanú ß- katenínom, čo je v súlade s predchádzajúcimi správami 13, 14, 42 .

Expresia chimérickej molekuly E-kadherín-α-katenínu, ktorá funguje ako bunková adhézna molekula nezávislá od β-katenínu, obnovuje kontaktnú inhibíciu a závislosť rastu od ukotvenia.

Aby sme získali hlbší prehľad o úlohe komplexu kadherín-katenín, exprimovali sme mutantný E-kadherín (ELA) alebo chiméru E-kadherín-a-katenínu (ELAαC) v bunkách DNCT +. ELA je mutantný E-kadherín, v ktorom boli dva leucínové zvyšky v pozíciách 587 a 588 nahradené dvoma alanínovými zvyškami (substitúcia LA). Táto substitúcia zlepšuje lokalizáciu E-kadherínu na bunkovom povrchu, keď nie je k dispozícii β-katenín. Aj keď dôvod nie je jasný, zavedenie LA substitúcie do EAC zvýšilo účinnosť lokalizácie fúzneho proteínu na bunkovom povrchu v epitelových bunkách, ako sú napríklad bunky MDCK. ELAaC, chimérna molekula E-kadherínu a a-katenínu, neinteraguje s P-katenínom, ale stále funguje ako molekula bunkovej adhézie 25 . Aj keď expresia ELA v bunkách DNCT + nezmenila počet Ki-67-pozitívnych buniek, expresia ELAaC znížila počet Ki-67-pozitívnych buniek (obrázok 1d, pravé dva panely). Keď sa tieto bunky kultivovali v podmienkach suspenzie, DNCT + bunky exprimujúce ELAaC vykazovali významné zníženie proliferácie buniek, zatiaľ čo expresia ELA nemala žiadny účinok (obrázok 2b). Expresia ELAaC v DNCT + bunkách tak obnovila kontaktnú inhibíciu a rastovú závislosť na ukotvení.

ELAaC má C -koncovú jednu tretinu a-katenínového polypeptidu (zvyšky 612 - 906). Väzbové miesto a-katenínu z Merlinu bolo mapované na jeho N-terminálnu VH1 doménu 32 . V súlade s tým imunoprecipitácia ELAaC s anti-HA protilátkou, nasledovaná imunoblottingom na detekciu Merlinu, odhalila, že ELAaC sa neviaže s Merlinom (obrázok 4f). Keď boli bunky DNCT + exprimujúce ELAaC farbené anti-Merlinovou protilátkou, bola na membráne detegovaná významná časť Merlinu, zatiaľ čo v DNCT + exprimujúcom ELA zostal Merlin prevažne v cytoplazme (Obr. 4g). Zostáva nejasné, ako môže ELAαC, chimérna molekula E-kadherín-α-katenínu, ktorá nemá väzbové miesto pre Merlin, indukovať membránovú lokalizáciu Merlinu. Je zrejmé, že je rozhodujúce obnovenie alebo vytvorenie adhézie buniek medzi bunkami, a nie jednoduchá molekulárna interakcia medzi α-katenínom a Merlinom.

Ďalej sme skúmali, či lokalizácia TAZ bola ovplyvnená expresiou ELAaC v bunkách DNCT +. Hoci významná časť TAZ bola lokalizovaná v jadre v DNCT + bunkách, jej distribúcia nebola ovplyvnená expresiou ELA. Naproti tomu expresia ELAaC zmenila distribúciu TAZ, čo spôsobilo, že bol vylúčený z jadra a prevažne lokalizovaný v cytoplazme (obr. 5a, pravé dva panely).

DNCT pôsobí v cytoplazme

Ukázalo sa, že produkt štiepenia ε-štiepenia N-kadherínu, rozpustnej cytoplazmatickej domény N-kadherínu, viaže transkripčný faktor CBP (proteín viažuci CREB), podporuje jeho proteazomálnu degradáciu a inhibuje transaktiváciu závislú od CRE 43, Doména teda funguje ako silný represor transkripcie sprostredkovanej CBP / CREB (proteín viažuci sa na element viažuci sa na AMP). Je zaujímavé, že na rozdiel od týchto správ sa ukázalo, že rozpustná cytoplazmatická N-kadherínová doména sa tiež translokuje do jadra a zvyšuje signalizáciu 44-45 -p-katenínu. Ďalej sa ukázalo, že jadrová expresia cytoplazmatickej domény E-kadherínu značenej NLS potláča apoptózu indukovanú staurosporínom 46 . Preto sme sa pýtali, či nukleárna lokalizácia DNCT uľahčila inhibíciu anoikis. Za týmto účelom sme pripravili konštrukt kódujúci DNCT s SV40 veľkým T antigénom NLS SV40 na jeho C -konci (DNCTNLS; obr. 7a) a zaviedli ho do buniek T23 MDCK. Hoci imunoblotová analýza odhalila, že stabilné transfektanty produkovali porovnateľné množstvá DNCT a DNCTNLS (obr. 7b), expresia DNCTNLS nezmenila hladiny E-kadherínu, a-katenínu alebo p-katenínu (obr. 7c) ani neovplyvnil transport endogénneho E-kadherínu na bunkovom povrchu (obr. 7d) alebo nevyčerpal p-katenín z bunkového povrchu (obr. 7e). Rovnako ako v prípade p-katenínu sa signifikantná frakcia a-katenínu kolonizovala s DNCTNLS v jadre, zatiaľ čo Merlin zostal na bunkovom povrchu (obrázok 7f). A čo je dôležitejšie, po 3 dňoch v suspenznej kultúre sa väčšina (> 80%) buniek DNCTNLS + s ošetrením Dox alebo bez neho farbila anexínom V (obr. 7g). Pridanie NLS k DNCT tak deaktivovalo jeho schopnosť potlačiť anoikis. V zhode s týmito pozorovaniami DNCTNLS nedokázalo zosilniť signalizáciu ERK za normálnych (pripojených) aj podmienečných podmienok (obr. 7h).

Image

( a ) Schematické znázornenie DNCTNLS, derivátu DNCT s veľkým T antigénom SV40 na C -konci. DNCTNLS a DNCT majú na svojich C- koncoch značku FLAG. b ) Imunoblotová analýza odhalila, že stabilné transfektanty produkovali porovnateľné množstvá DNCT a DNCTNLS. Bloty sa skúšali s anti-vinkulínom (kontrola nanášania) a anti-FLAG protilátkami. ( c ) Imunoblotová analýza odhalila, že hladiny E-kadherínu, a-katenínu a p-katenínu sa po expresii DNCTNLS nemenia. d ) DNCTNLS nepoškodzuje transport endogénneho E-kadherínu na bunkovom povrchu. E-kadherín sa detegoval pomocou DECMA-1. ( e ) DNCTNLS indukuje jadrovú akumuláciu p-katenínu, ale nedeplikuje p-katenín z bunkového povrchu. ( f ) Ako v prípade p-katenínu, značná časť a-katenínu kolonizovaná s DNCTNLS v jadre, ale Merlin zostal na membráne bunkového povrchu. K interakcii Merlinu s a-katenínom teda dochádza v cytoplazme, ale nie v jadre. Tyčinky, 25 um. g ) DNCTNLS neinhibuje anoikis. Bunky boli kultivované v suspenzii v prítomnosti (+) alebo neprítomnosti (-) Dox počas 3 dní a potom zafarbené FITC-annexinom V. ( h ) DNCTNLS nedokázalo zosilniť signalizáciu ERK. Bunky DNCTNLS + boli kultivované na normálnych doštičkách (pripevnené) alebo na doštičkách s ultra nízko pripevnenými (suspenzia) v prítomnosti (+) alebo neprítomnosti (-) Dox. Potom boli bunky pozbierané a extrakty boli analyzované imunoblotom s použitím uvedených protilátok. V ( c, h ) sa ako kontrola nanášania použil vinculin.

Obrázok v plnej veľkosti

diskusia

Epitelové bunky vykazujú kontaktnú inhibíciu vyplývajúcu z interakcií bunka-bunka. Inhibícia kontaktu zaisťuje, že epitelové bunky sa prestanú množiť, keď dosiahnu sútok. Väčšina ľudských rakovinových buniek je odolná voči kontaktnej inhibícii. V dôsledku toho sú schopné pokračovať v množení napriek interakciám so susednými bunkami. Mnoho zavedených rakovinových bunkových línií tiež vykazuje rast in vitro, ktorý je odolný voči kontaktnej inhibícii, a často vykazujú na mäkkom agare rast nezávislý od ukotvenia. Strata kontaktnej inhibície a zisk rastu nezávislého od ukotvenia sú charakteristickými znakmi rakovinových buniek in vitro 47 .

Kadheríny sprostredkujú adhéziu buniek a tvorbu bunkových spojov závislých od Ca2 + a ich cytoplazmatické domény sú spojené s rôznymi katenínmi, ktoré sprostredkúvajú cytoskeletálnu asociáciu a signalizáciu 48 . E-kadherín je exprimovaný v epitelových bunkách a intercelulárna homofilná väzba E-kadherínu vedie k vytvoreniu epitelového spojovacieho komplexu a tesnej polarizovanej bunkovej vrstvy 48 . Strata expresie E-kadherínu genetickými alebo epigenetickými zmenami podporuje progresiu nádoru a metastázy 49, 50 . Na druhej strane nadmerná expresia E-kadherínu v rakovinových bunkách bráni progresii a invázii nádorov 50, 51 . Táto inhibícia má dvojaký pôvod, a to vďaka adhéznej funkcii E-kadherínu na povrchu bunky, ktorá fyzicky blokuje pohyb buniek a uľahčuje ďalšie interakcie bunka-bunka, a jej inhibícii signalizácie β-katenínu a ďalších dráh signalizácie rastu 11 16, 42 . Predpokladá sa teda, že adhézia bunka-bunka sprostredkovaná kadherínom hrá dôležitú úlohu pri inhibícii kontaktu. Mechanizmy, ktoré sú základom kontaktnej inhibície proliferácie, však stále nie sú dostatočne známe.

V tomto článku sme ukázali, že expresia DNCT (rozpustná cytoplazmatická doména N-kadherínu) v MDCK bunkách podporovala proliferáciu buniek na plastových miskách, v suspenzných kultúrach a na mäkkom agare a udeľovala rezistenciu voči anoikis. Bunky DNCT + mali vyššie hladiny fosfo-Erkl / 2 a cyklínu Dl. Zníženie expresie DNCT pridaním Dox zrušilo proliferáciu buniek a znížilo hladiny fosfo-Erkl / 2 a cyklínu Dl, čo demonštruje, že expresia DNCT viedla k týmto zmenám. Pridanie PD0325901, inhibítora MEK, kinázy, ktorá fosforyluje ERK1 / 2, významne znížilo proliferáciu buniek v suspenzných kultúrach. DNCT interagoval s nádorovým supresorom Merlin prostredníctvom asociácií s a- a P-katenínom. Táto interakcia zmenila distribúciu Merlinu z bunkového povrchu, kde reguluje mitogénne dráhy, do cytoplazmy a pravdepodobne zrušila jeho aktivitu. Pretože Merlin je kritickým mediátorom kontaktne závislej inhibície proliferácie a supresora rastu nezávislého od ukotvenia, inaktivácia Merlinu mohla viesť k pozorovanému zvýšeniu fosfo-MAPK a cyklínu Dl, čo zasa spôsobilo stratu kontaktnej inhibície a získanie rezistencie na anoikis v bunkách DNCT +. Nevieme dôvod, prečo fúzny proteín E-kadherín-a-katenín, ktorému chýba väzobné miesto pre Merlin, obnovil membránovú lokalizáciu Merlin, kontaktnú inhibíciu a závislosť rastu od ukotvenia. Uvádza sa, že mutant Merlin, ktorému chýba 17 aminokyselín na N-konci, sa nemôže asociovať s a-katenínom, ale stále môže interagovať s Par332. Už skôr sme zistili, že expresia chiméry v bunkách DECT + obnovila adhéziu a vytváranie spojení medzi bunkami, vrátane tesného spojenia 25 . Merlin pravdepodobne zostaví niekoľko rôznych komplexov aj v rámci danej bunky. Zostavenie takýchto komplexov môže byť zodpovedné za membránovú lokalizáciu Merlina, kontaktnú inhibíciu a závislosť rastu od ukotvenia v bunkách exprimujúcich fúzny proteín.

Dráha Wnt / P-katenínu prispieva k samoobnoveniu kmeňových buniek a / alebo progenitorových buniek v rôznych tkanivách. Deregulovaná aktivácia tejto dráhy sa teda podieľa na mnohých rakovinách 3 . Pretože p-katenín je kritickým hráčom v dráhe transdukcie signálu Wnt 3, ukázalo sa, že sekvestrácia p-katenínu cytoplazmatickou doménou kadherínu bráni jeho jadrovej translokácii a inhibuje transkripčnú aktivitu sprostredkovanú p-katenínom 12, 13, 14 . Inhibícia signalizácie p-katenínu E-kadherínom môže mať za následok potlačenie bunkového rastu, čo poskytuje molekulárny základ pre adhézne nezávislé tumor-supresorové funkcie E-kadherínu 38 . V súlade s týmito predchádzajúcimi správami, expresia DNCT inhibovala signalizáciu p-katenínu. Preto sa p-katenínová signalizácia nezúčastňovala na strate kontaktnej inhibície a získaní rezistencie na anoikis v bunkách DNCT +.

Bolo preukázané, že stabilná nadmerná expresia p-katenínu v MDCK bunkách zvyšuje signalizačnú aktivitu p-katenínu, stimuluje proliferáciu buniek pri vysokých hustotách buniek, podporuje tvorbu kolónií na mäkkom agare a inhibuje anoikis 9 . Expresia β-katenínu v iných bunkových typoch tiež zabraňuje anoikis, aktivuje β-katenín-LEF-responzívny reportérový gén a indukuje expresiu endogénneho cyklínu D1 (cieľ β-katenínovej signalizácie) 10 . Rezistencia na anoikis korelovala so zvýšenou fosforyláciou MAP kinázy a bola zrušená pôsobením inhibítora MAP kinázovej dráhy, PD98059. MAP kináza teda tiež zohrávala rozhodujúcu úlohu v rezistencii na anoikis spôsobenú expresiou p-katenínu. Mechanizmus, ktorým p-katenín môže aktivovať p42 / 44 MAP kinázu, ešte nie je definovaný.

Hoci expresia DNCT indukovala jadrovú akumuláciu TAZ, signalizácia YAP / TAZ nebola aktivovaná. Nevieme, prečo TAZ nebola aktívna napriek svojej jadrovej lokalizácii. Existuje niekoľko správ naznačujúcich úzku koreláciu medzi dráhou Wnt / P-katenínu a dráhou Hippo / YAP / TAZ. Konkrétne je YAP1 regulovaný Wnt / ß-katenínovou dráhou 52, Hippo / YAP / TAZ dráha reguluje ß-katenínovú signalizáciu 53, 54, 55 a YAP1 je nevyhnutný pre p-katenín závislé rakoviny 56 . Jedným možným vysvetlením je, že aktivita YAP / TAZ vyžaduje P-katenín. Expresia DNCT môže znížiť dostupnosť p-katenínu pre signalizáciu YAP / TAZ a potlačiť aktivitu YAP / TAZ. V takom prípade by to bol prvý experiment, ktorý ukazuje, že aktivita YAP / TAZ vyžaduje P-katenín.

metódy

Konštrukcia cDNA

Vektory (pC-DNCT), ktoré obsahujú konštrukt cytoplazmatickej domény N-kadherínovej domény označenej N-terminálne DsRed a C -terminálne FLAG, a (pU-DNCT), expresný vektor pre DNCT pod kontrolou Tet- represorový transaktivátor 57, boli opísané skôr 25 . Vektor obsahujúci DNCTSA, derivát DNCT s alanínovými substitúciami konzervovaných osem zvyškov serínu v väzbovom mieste katenínu, sa skonštruoval rovnakým spôsobom s použitím pC-NSAHA 58 ako templátu PCR. Expresný vektor pre DNCTNLS bol skonštruovaný inzerciou dvojvláknových oligonukleotidov (CCGGTCCAAAAAAGAAGAGAAAGGTAGAT a ATCTACCTTTCTCTTCTTTTTTGG), kódujúcich SV40 NLS (PKKKRKV) medzi N-kadherínovou cytoplazmatickou doménou. Vektory, pC-ELAHA a pC-ELAaCHA, kódujúce deriváty E-kadherínu, boli opísané skôr 25 .

Plazmid 8x GTIIC-luciferázy obsahujúci 8 väzbových miest TEAD (ACATTCCA) 20 bol získaný od Addgene (Cambridge, MA, USA). Aby sa skonštruoval reportérový plazmid 8x GTIIC-EGFP, cDNA kódujúca luciferázu z plazmidu 8x GTIIC-luciferázy sa odstránila štiepením Ncol a EcoNI a nahradila sa EGFP cDNA izolovaná štiepením Ncol a NotI. Na konštrukciu reportérového plazmidu, pTOP-EGFP, boli oblasti promótora / zosilňovača expresného vektora pEGFPN1 (Clontech, Mountain View, CA, USA) odstránené štiepením pomocou Xhol a AseI a nahradené fragmentom Xbal z TCF- aktivovateľný plazmid pTOPFLASH, obsahujúci tri prvky viažuce TCF pred c-fos minimálnym promótorom 39 . Všetky produkty PCR boli sekvenované a klonované do expresných vektorov. Bol opísaný pCAGGShyg, ktorý udeľuje rezistenciu na hygromycín 25 . Vektor pCAG / bsr-7 obsahujúci gén 25 rezistentný na blasticidín poskytol Masahiro Sato (Kagoshima University).

Bunky a transfekcie

Bunky boli transfekované expresnými vektormi a vybrané pomocou hygromycínu (300 μg / ml) alebo blasticidínu (8 μg / ml). Stabilné transfektanty exprimujúce očakávané proteíny boli identifikované fluorescenčnou mikroskopiou a imunoblotom a boli izolované, ako už bolo opísané. Pre každý konštrukt boli vybrané najmenej tri nezávislé klony, aby sa zabezpečilo, že žiadne pozorované účinky neboli spôsobené fenotypovou variabilitou zavedenou klonálnou selekciou. Bunky MDCK T23 59, 60 (poskytované W. Jamesom Nelsonom, Stanfordská univerzita) boli transfekované pU-DNCT (15 μg) a pCAGGGShyg (1, 5 μg) s použitím fosforečnanu vápenatého a klony rezistentné na hygromycín boli izolované a skúmané na expresiu DNCT ako described above. For repression of DNCT expression, cells were cultured in the presence of doxycycline (Dox, 20 ng/ml) for the indicated period. Since DNCT MDCK T23 cells already had G418-, puromycin-, and hygromycin-resistance, we used a pCAG/bsr-7 vector with a blasticidin-resistance gene to isolate DNCT+ cells expressing 8×GTIIC-EGFP or TOP-EGFP.

protilátky

DECMA-1, a mAb recognizing the extracellular domain of E-cadherin (provided by Rolf Kemler, Max-Planck Institute for Immunobiology) was used to detect E-cadherin. A mouse mAb recognizing FLAG (DYKDDDDK) was purchased from Wako Pure Chemical Industries, Ltd. (Osaka, Japan). Mouse mAbs recognizing β-catenin and TAZ were purchased from BD Biosciences (Lexington, KY, USA); mAbs recognizing vinculin, actin, and pan-cadherin were obtained from Sigma-Aldrich Japan (Tokyo, Japan). Anti-Ki-67 was from Dako Japan (Tokyo, Japan). The rabbit mAbs, p44/42 MAPK (Erk1/2), phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204), Akt, phospho-Akt (Ser473), phospho-Merlin (Ser518), YAP, and the rabbit polyclonal antibody, phospho-Merlin (Ser518) were from Cell Signaling Technology (Danvers, MA, USA). Rabbit anti-Merlin (NF2) and anti-CTGF (connective tissue growth factor) were from Santa Cruz Biotechnology (Dallas, TX, USA). Rabbit anti-cyclin D1 was obtained from MBL Japan (Nagoya, Japan). All secondary antibodies were obtained from Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA, USA).

Immunoprecipitation and immunoblotting

Immunoprecipitation and immunoblot analyses were carried out as described 25 . In brief, cells (2 × 10 6 ) were lysed in a buffer of 25 mM Tris-HCl pH 7.4, 1% Triton X-100, 2 mM EDTA, 10 mM sodium pyrophosphate, 10 mM NaF, 1 mM Na 3 VO 4, 1 mM PMSF, 10 μg/ml leupeptin, and 25 μg/ml aprotinin. Proteins of interest were enriched by using mAbs that had been preabsorbed to protein G-Sepharose. Western blot signals were quantitated using the ImageJ software, and relative intensities were calculated after normalization against the corresponding vinculin signals.

Cell fractionation

Cells were washed with ice-cold phosphate-buffered saline (PBS) and collected in 1 ml of ice-cold PBS containing protease inhibitors, and then passed 10 times through a 22-gauge needle. The homogenized cells were centrifuged at 14, 000 × g for 30 min at 4 °C. Proteins of the supernatant (cytosolic protein) and the pellet (membrane protein) fractions were subjected to immunoblot analysis as described above.

Fluorescenčná mikroskopia

Immunofluorescence labeling of cells was performed as described 25 . In brief, cells were fixed with 3% paraformaldehyde in PBS for 20 min at room temperature. Cells were permeabilized with 0.1% Triton X-100, and then incubated with primary and secondary antibodies. Cells were analyzed using an Olympus fluorescence microscope (Tokyo, Japan) equipped with a CD72 camera (Olympus).

Prietoková cytometria

Cells were incubated for 2 d with or without Dox, trypsinized, and then 1 × 10 5 cells were plated and cultured on 35 mm dishes for 24 h under the conditions specified. EGFP expression in DNCT+ cells that were stably transfected with the reporter plasmid pTOP-EGFP and stimulated by the addition of LPA or BIO was analyzed on a Beckman Coulter CyAn ADP analyzer (Beckman Coulter Japan, Tokyo, Japan).

Quantification of cell shedding

Cells were seeded at a density of 5 × 10 5 cells/well on Corning Transwell 3412 plates (Costar, Cambridge, MA, USA). At the times indicated, media were removed, cells were trypsinized, and the cells in the media and on the membranes were counted using a hemocytometer.

Anoikis assay

Cells were seeded onto ultra-low attachment plates for suspension culture. After 3 d, cells were harvested, incubated with FITC-annexin V (1 pg/ml; MBL) for 10 min, and the percentage of stained cells was determined using a fluorescence microscope.

WST-1 cell proliferation assay

A WST-1 assay for cell proliferation, which measures succinate-tetrazolium reductase activity, was performed according to the manufacturer's instructions (Dojindo Co. Kumamoto, Japan). Briefly, cells (2 × 10 4 ) were suspended in 1 ml of DME containing 10% FBS and cultured in 24-well tissue culture plates or on ultra-low attachment plates for 5 d. Cell proliferation reagent (100 μl per well) was added and cells were incubated at 37 °C for 10–30 min. The number of viable cells was obtained by measuring the optical density (OD) at 450 nm.

Soft agar colony assay

Cells (5 × 10 3 ) were suspended in 1.5 ml of DME containing 10% FBS and 0.35% agar (Difeo Laboratories, Detroit, MI, USA), and plated into the same medium containing 0.5% agar on a 6-well plate. The wells were covered with 1 ml of culture medium. Cells were incubated with or without Dox (20 ng/ml) for 21 d at 37 °C. Colonies were stained with 0.05% crystal violet for visualization.

Génová expresná mikročip a analýza dát

DNCT+ cells were cultured for 2 d with or without Dox, and then total RNA was prepared using TRIzol Reagent (Life Technologies Japan, Tokyo, Japan) and purified using the SV Total RNA Isolation System (Promega KK, Tokyo, Japan). cRNA was amplified and labeled using a Quick Amp Labeling Kit (Agilent Technologies, Santa Clara, CA, USA) and hybridized to a 44 K Agilent 60-mer oligomicroarray (Canine Oligo Microarray Kit; Agilent Technologies). The hybridized microarray slides were scanned using an Agilent scanner. The relative hybridization intensities and background hybridization values were calculated using Agilent Feature Extraction Software (version 9.5.1.1). Microarray data analysis was supported by Cell Innovator (Fukuoka, Japan).

Ďalšie informácie

How to cite this article : Ozawa, M. The N-cadherin cytoplasmic domain confers anchorage-independent growth and the loss of contact inhibition. Sci. Rep. 5, 15368; doi: 10.1038/srep15368 (2015).

Doplnková informácia

Súbory PDF

  1. 1.

    Supplementary Table S1 & S2

Komentáre

Odoslaním komentára súhlasíte s tým, že budete dodržiavať naše zmluvné podmienky a pokyny pre komunitu. Ak zistíte, že je niečo urážlivé alebo nie je v súlade s našimi podmienkami alebo pokynmi, označte ho ako nevhodné.